ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407008

Name

MIR223

Synonym

MIRN223|miRNA223|mir-223;microRNA 223;MIR223;microRNA 223

Definition

hsa-mir-223

Position

Xq12

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407008

Links to epithelial mesenchymal transition gene database

407008

Links to ovarian cancer gene database

407008

Links to endometrial cancer gene database

407008

Links to iHOP

407008

Sequence Information

Nucleotide Sequence

>407008 : length: 110
CCTGGCCTCCTGCAGTGCCACGCTCCGTGTATTTGACAAGCTGAGTTGGACACTCCATGT
GGTAGAGTGTCAGTTTGTCAAATACCCCAAGTGCGGCACATGCTTACCAG

Protein Sequence

>407008 : length: 3
N/A