ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407007

Name

MIR222

Synonym

MIRN222|miRNA222|mir-222;microRNA 222;MIR222;microRNA 222

Definition

hsa-mir-222

Position

Xp11.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407007

Links to epithelial mesenchymal transition gene database

407007

Links to ovarian cancer gene database

407007

Links to endometrial cancer gene database

407007

Links to iHOP

407007

Sequence Information

Nucleotide Sequence

>407007 : length: 110
GCTGCTGGAAGGTGTAGGTACCCTCAATGGCTCAGTAGCCAGTGTAGATCCTGTCTTTCG
TAATCAGCAGCTACATCTGGCTACTGGGTCTCTGATGGCATCTTCTAGCT

Protein Sequence

>407007 : length: 3
N/A