ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

407006

Name

MIR221

Synonym

MIRN221|miRNA221|mir-221;microRNA 221;MIR221;microRNA 221

Definition

hsa-mir-221

Position

Xp11.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

407006

Links to epithelial mesenchymal transition gene database

407006

Links to ovarian cancer gene database

407006

Links to endometrial cancer gene database

407006

Links to iHOP

407006

Sequence Information

Nucleotide Sequence

>407006 : length: 110
TGAACATCCAGGTCTGGGGCATGAACCTGGCATACAATGTAGATTTCTGTGTTCGTTAGG
CAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAAACATGTTCTC

Protein Sequence

>407006 : length: 3
N/A