ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406994

Name

MIR212

Synonym

MIRN212|mir-212;microRNA 212;MIR212;microRNA 212

Definition

hsa-mir-212

Position

17p13.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406994

Links to epithelial mesenchymal transition gene database

406994

Links to ovarian cancer gene database

406994

Links to endometrial cancer gene database

406994

Links to iHOP

406994

Sequence Information

Nucleotide Sequence

>406994 : length: 110
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCTTGGCTCTAGACTGCTTACTGCCCGGG
CCGCCCTCAGTAACAGTCTCCAGTCACGGCCACCGACGCCTGGCCCCGCC

Protein Sequence

>406994 : length: 3
N/A