ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406991

Name

MIR21

Synonym

MIRN21|hsa-mir-21|miR-21|miRNA21;microRNA 21;MIR21;microRNA 21

Definition

-

Position

17q23.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406991

Links to epithelial mesenchymal transition gene database

406991

Links to ovarian cancer gene database

406991

Links to endometrial cancer gene database

406991

Links to iHOP

406991

Sequence Information

Nucleotide Sequence

>406991 : length: 72
TGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATG
GGCTGTCTGACA

Protein Sequence

>406991 : length: 3
N/A