ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406985

Name

MIR200C

Synonym

MIRN200C;microRNA 200c;MIR200C;microRNA 200c

Definition

hsa-mir-200c

Position

12p13.31

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406985

Links to epithelial mesenchymal transition gene database

406985

Links to ovarian cancer gene database

406985

Links to endometrial cancer gene database

406985

Links to iHOP

406985

Sequence Information

Nucleotide Sequence

>406985 : length: 68
CCCTCGTCTTACCCAGCAGTGTTTGGGTGCGGTTGGGAGTCTCTAATACTGCCGGGTAAT
GATGGAGG

Protein Sequence

>406985 : length: 3
N/A