ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406982

Name

MIR20A

Synonym

MIR20|MIRN20|MIRN20A|hsa-mir-20|hsa-mir-20a|miR-20|miRNA20A;microRNA 20a;MIR20A;microRNA 20a

Definition

-

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406982

Links to epithelial mesenchymal transition gene database

406982

Links to ovarian cancer gene database

406982

Links to endometrial cancer gene database

406982

Links to iHOP

406982

Sequence Information

Nucleotide Sequence

>406982 : length: 71
GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTATGAGCACT
TAAAGTACTGC

Protein Sequence

>406982 : length: 3
N/A