ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406980

Name

MIR19B1

Synonym

MIRN19B1|miR-19b-1|miRNA19B1;microRNA 19b-1;MIR19B1;microRNA 19b-1

Definition

hsa-mir-19b-1

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406980

Links to epithelial mesenchymal transition gene database

406980

Links to ovarian cancer gene database

406980

Links to endometrial cancer gene database

406980

Links to iHOP

406980

Sequence Information

Nucleotide Sequence

>406980 : length: 87
CACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGATATTCTGCTGTGCAA
ATCCATGCAAAACTGACTGTGGTAGTG

Protein Sequence

>406980 : length: 3
N/A