ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406979

Name

MIR19A

Synonym

MIRN19A|hsa-mir-19a|miR-19a|miRNA19A;microRNA 19a;MIR19A;microRNA 19a

Definition

-

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406979

Links to epithelial mesenchymal transition gene database

406979

Links to ovarian cancer gene database

406979

Links to endometrial cancer gene database

406979

Links to iHOP

406979

Sequence Information

Nucleotide Sequence

>406979 : length: 82
GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTGCAAATCTA
TGCAAAACTGATGGTGGCCTGC

Protein Sequence

>406979 : length: 3
N/A