ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406976

Name

MIR199A1

Synonym

MIR-199-s|MIRN199A1;microRNA 199a-1;MIR199A1;microRNA 199a-1

Definition

hsa-mir-199a-1

Position

19p13.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406976

Links to epithelial mesenchymal transition gene database

406976

Links to ovarian cancer gene database

406976

Links to endometrial cancer gene database

406976

Links to iHOP

406976

Sequence Information

Nucleotide Sequence

>406976 : length: 71
GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCAATGTGTACAGTAGTCTGCAC
ATTGGTTAGGC

Protein Sequence

>406976 : length: 3
N/A