ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406972

Name

MIR196A1

Synonym

MIRN196-1|MIRN196A1;microRNA 196a-1;MIR196A1;microRNA 196a-1

Definition

hsa-mir-196-1|hsa-mir-196a-1|microRNA 196-1|microRNA 196a|microRNA miR-196

Position

17q21.32

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406972

Links to epithelial mesenchymal transition gene database

406972

Links to ovarian cancer gene database

406972

Links to endometrial cancer gene database

406972

Links to iHOP

406972

Sequence Information

Nucleotide Sequence

>406972 : length: 70
GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAACATTAAACCA
CCCGATTCAC

Protein Sequence

>406972 : length: 3
N/A