ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406966

Name

MIR191

Synonym

MIRN191|miR-191;microRNA 191;MIR191;microRNA 191

Definition

hsa-mir-191

Position

3p21.31

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406966

Links to epithelial mesenchymal transition gene database

406966

Links to ovarian cancer gene database

406966

Links to endometrial cancer gene database

406966

Links to iHOP

406966

Sequence Information

Nucleotide Sequence

>406966 : length: 92
CGGCTGGACAGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGCATTCCAGCT
GCGCTTGGATTTCGTCCCCTGCTCTCCTGCCT

Protein Sequence

>406966 : length: 3
N/A