ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406960

Name

MIR184

Synonym

EDICT|MIRN184|miR-184;microRNA 184;MIR184;microRNA 184

Definition

hsa-mir-184

Position

15q25.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406960

Links to epithelial mesenchymal transition gene database

406960

Links to ovarian cancer gene database

406960

Links to endometrial cancer gene database

406960

Links to iHOP

406960

Sequence Information

Nucleotide Sequence

>406960 : length: 84
CCAGTCACGTCCCCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGTGTTGGACGGA
GAACTGATAAGGGTAGGTGATTGA

Protein Sequence

>406960 : length: 3
N/A