ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406959

Name

MIR183

Synonym

MIRN183|miR-183|miRNA183;microRNA 183;MIR183;microRNA 183

Definition

hsa-mir-183

Position

7q32.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406959

Links to epithelial mesenchymal transition gene database

406959

Links to ovarian cancer gene database

406959

Links to endometrial cancer gene database

406959

Links to iHOP

406959

Sequence Information

Nucleotide Sequence

>406959 : length: 110
CCGCAGAGTGTGACTCCTGTTCTGTGTATGGCACTGGTAGAATTCACTGTGAACAGTCTC
AGTCAGTGAATTACCGAAGGGCCATAAACAGAGCAGAGACAGATCCACGA

Protein Sequence

>406959 : length: 3
N/A