ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406958

Name

MIR182

Synonym

MIRN182|miRNA182;microRNA 182;MIR182;microRNA 182

Definition

hsa-mir-182

Position

7q32.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406958

Links to epithelial mesenchymal transition gene database

406958

Links to ovarian cancer gene database

406958

Links to endometrial cancer gene database

406958

Links to iHOP

406958

Sequence Information

Nucleotide Sequence

>406958 : length: 110
GAGCTGCTTGCCTCCCCCCGTTTTTGGCAATGGTAGAACTCACACTGGTGAGGTAACAGG
ATCCGGTGGTTCTAGACTTGCCAACTATGGGGCGAGGACTCAGCCGGCAC

Protein Sequence

>406958 : length: 3
N/A