ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406953

Name

MIR18A

Synonym

MIR18|MIRN18|MIRN18A|hsa-mir-18|hsa-mir-18a|miR-18|miRNA18A;microRNA 18a;MIR18A;microRNA 18a

Definition

-

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406953

Links to epithelial mesenchymal transition gene database

406953

Links to ovarian cancer gene database

406953

Links to endometrial cancer gene database

406953

Links to iHOP

406953

Sequence Information

Nucleotide Sequence

>406953 : length: 71
TGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACTGCCCTAAGTGC
TCCTTCTGGCA

Protein Sequence

>406953 : length: 3
N/A