ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406952

Name

MIR17

Synonym

MIR17-5p|MIR91|MIRN17|MIRN91|hsa-mir-17|miR-17|miR17-3p|miRNA17|miRNA91;microRNA 17;MIR17;microRNA 17

Definition

-

Position

13q31.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406952

Links to epithelial mesenchymal transition gene database

406952

Links to ovarian cancer gene database

406952

Links to endometrial cancer gene database

406952

Links to iHOP

406952

Sequence Information

Nucleotide Sequence

>406952 : length: 84
GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTACTGCAGTGA
AGGCACTTGTAGCATTATGGTGAC

Protein Sequence

>406952 : length: 3
N/A