ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406950

Name

MIR16-1

Synonym

MIRN16-1|miRNA16-1;microRNA 16-1;MIR16-1;microRNA 16-1

Definition

hsa-mir-16-1

Position

13q14.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406950

Links to epithelial mesenchymal transition gene database

406950

Links to ovarian cancer gene database

406950

Links to endometrial cancer gene database

406950

Links to iHOP

406950

Sequence Information

Nucleotide Sequence

>406950 : length: 89
GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTATCTCCAGT
ATTAACTGTGCTGCTGAAGTAAGGTTGAC

Protein Sequence

>406950 : length: 3
N/A