ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406947

Name

MIR155

Synonym

MIRN155|miRNA155;microRNA 155;MIR155;microRNA 155

Definition

hsa-mir-155

Position

21q21.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406947

Links to epithelial mesenchymal transition gene database

406947

Links to ovarian cancer gene database

406947

Links to endometrial cancer gene database

406947

Links to iHOP

406947

Sequence Information

Nucleotide Sequence

>406947 : length: 65
CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATT
AACAG

Protein Sequence

>406947 : length: 3
N/A