ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406942

Name

MIR150

Synonym

MIRN150|miRNA150;microRNA 150;MIR150;microRNA 150

Definition

hsa-mir-150

Position

19q13.33

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406942

Links to epithelial mesenchymal transition gene database

406942

Links to ovarian cancer gene database

406942

Links to endometrial cancer gene database

406942

Links to iHOP

406942

Sequence Information

Nucleotide Sequence

>406942 : length: 84
CTCCCCATGGCCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGACCCTGGTACAGG
CCTGGGGGACAGGGACCTGGGGAC

Protein Sequence

>406942 : length: 3
N/A