ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406941

Name

MIR149

Synonym

MIRN149;microRNA 149;MIR149;microRNA 149

Definition

hsa-mir-149

Position

2q37.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406941

Links to epithelial mesenchymal transition gene database

406941

Links to ovarian cancer gene database

406941

Links to endometrial cancer gene database

406941

Links to iHOP

406941

Sequence Information

Nucleotide Sequence

>406941 : length: 89
GCCGGCGCCCGAGCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGAGGGAGGGA
GGGACGGGGGCTGTGCTGGGGCAGCTGGA

Protein Sequence

>406941 : length: 3
N/A