ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406925

Name

MIR135A1

Synonym

MIRN135-1|MIRN135A1;microRNA 135a-1;MIR135A1;microRNA 135a-1

Definition

hsa-mir-135-1|hsa-mir-135a-1|microRNA 135-1

Position

3p21.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406925

Links to epithelial mesenchymal transition gene database

406925

Links to ovarian cancer gene database

406925

Links to endometrial cancer gene database

406925

Links to iHOP

406925

Sequence Information

Nucleotide Sequence

>406925 : length: 90
AGGCCTCGCTGTTCTCTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTCATATAG
GGATTGGAGCCGTGGCGCACGGCGGGGACA

Protein Sequence

>406925 : length: 3
N/A