ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406920

Name

MIR130B

Synonym

MIRN130B|mir-130b;microRNA 130b;MIR130B;microRNA 130b

Definition

hsa-mir-130b

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406920

Links to epithelial mesenchymal transition gene database

406920

Links to ovarian cancer gene database

406920

Links to endometrial cancer gene database

406920

Links to iHOP

406920

Sequence Information

Nucleotide Sequence

>406920 : length: 82
GGCCTGCCCGACACTCTTTCCCTGTTGCACTACTATAGGCCGCTGGGAAGCAGTGCAATG
ATGAAAGGGCATCGGTCAGGTC

Protein Sequence

>406920 : length: 3
N/A