ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406919

Name

MIR130A

Synonym

MIRN130A|miRNA130A;microRNA 130a;MIR130A;microRNA 130a

Definition

hsa-mir-130a

Position

11q12.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406919

Links to epithelial mesenchymal transition gene database

406919

Links to ovarian cancer gene database

406919

Links to endometrial cancer gene database

406919

Links to iHOP

406919

Sequence Information

Nucleotide Sequence

>406919 : length: 89
TGCTGCTGGCCAGAGCTCTTTTCACATTGTGCTACTGTCTGCACCTGTCACTAGCAGTGC
AATGTTAAAAGGGCATTGGCCGTGTAGTG

Protein Sequence

>406919 : length: 3
N/A