ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406915

Name

MIR128-1

Synonym

MIR128A|MIRN128-1|MIRN128A;microRNA 128-1;MIR128-1;microRNA 128-1

Definition

hsa-mir-128-1|hsa-mir-128a|microRNA 128a

Position

2q21.3

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406915

Links to epithelial mesenchymal transition gene database

406915

Links to ovarian cancer gene database

406915

Links to endometrial cancer gene database

406915

Links to iHOP

406915

Sequence Information

Nucleotide Sequence

>406915 : length: 82
TGAGCTGTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCACAGTGAAC
CGGTCTCTTTTTCAGCTGCTTC

Protein Sequence

>406915 : length: 3
N/A