ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406911

Name

MIR125B1

Synonym

MIRN125B1;microRNA 125b-1;MIR125B1;microRNA 125b-1

Definition

hsa-mir-125b-1

Position

11q24.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406911

Links to epithelial mesenchymal transition gene database

406911

Links to ovarian cancer gene database

406911

Links to endometrial cancer gene database

406911

Links to iHOP

406911

Sequence Information

Nucleotide Sequence

>406911 : length: 88
TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATCCACGGGT
TAGGCTCTTGGGAGCTGCGAGTCGTGCT

Protein Sequence

>406911 : length: 3
N/A