ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406903

Name

MIR10B

Synonym

MIRN10B|hsa-mir-10b|miRNA10B|mir-10b;microRNA 10b;MIR10B;microRNA 10b

Definition

-

Position

2q31.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406903

Links to epithelial mesenchymal transition gene database

406903

Links to ovarian cancer gene database

406903

Links to endometrial cancer gene database

406903

Links to iHOP

406903

Sequence Information

Nucleotide Sequence

>406903 : length: 110
CCAGAGGTTGTAACGTTGTCTATATATACCCTGTAGAACCGAATTTGTGTGGTATCCGTA
TAGTCACAGATTCGATTCTAGGGGAATATATGGTCGATGCAAAAACTTCA

Protein Sequence

>406903 : length: 3
N/A