ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406901

Name

MIR107

Synonym

MIRN107|miR-107;microRNA 107;MIR107;microRNA 107

Definition

hsa-mir-107

Position

10q23.31

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406901

Links to epithelial mesenchymal transition gene database

406901

Links to ovarian cancer gene database

406901

Links to endometrial cancer gene database

406901

Links to iHOP

406901

Sequence Information

Nucleotide Sequence

>406901 : length: 81
CTCTCTGCTTTCAGCTTCTTTACAGTGTTGCCTTGTGGCATGGAGTTCAAGCAGCATTGT
ACAGGGCTATCAAAGCACAGA

Protein Sequence

>406901 : length: 3
N/A