ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

406900

Name

MIR106B

Synonym

MIRN106B;microRNA 106b;MIR106B;microRNA 106b

Definition

hsa-mir-106b

Position

7q22.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

406900

Links to epithelial mesenchymal transition gene database

406900

Links to ovarian cancer gene database

406900

Links to endometrial cancer gene database

406900

Links to iHOP

406900

Sequence Information

Nucleotide Sequence

>406900 : length: 82
CCTGCCGGGGCTAAAGTGCTGACAGTGCAGATAGTGGTCCTCTCCGTGCTACCGCACTGT
GGGTACTTGCTGCTCCAGCAGG

Protein Sequence

>406900 : length: 3
N/A