ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

400500

Name

BCAR4

Synonym

breast cancer anti-estrogen resistance 4 (non-protein coding);BCAR4;breast cancer anti-estrogen resistance 4 (non-protein coding)

Definition

breast cancer antiestrogen resistance 4 protein

Position

16p13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

400500

Links to epithelial mesenchymal transition gene database

400500

Links to ovarian cancer gene database

400500

Links to endometrial cancer gene database

400500

Links to iHOP

400500

Sequence Information

Nucleotide Sequence

>400500 : length: 1314
AGTTAGTGCTGGGAAACAGTGCTAAGAAGGATACAGTGGCTAGAAGTCGTCCTGTCGTCC
TGCCTCACAGTAACATCGTTACCGAATTCTCAGCAGGTGAACCAAATGAAATGGTCAACT
GAAAGCCAACCAGGGTAAAACAGATCTTTTATTTCTTGTTGTTGTTATTATTATTTTTTT
TTATGTGGGGACATTCAAGTGAACTGCTATATGCATTTGCCCCCAGTCTCTCCTTGTGAG
AAGTGAATTTCTTCAACGTTTATAGAACTGAGGTATTACATTATTGGATGAATTAAGAAA
ACAATCTAACCTGATGTGTGAAAATTTCTGCTTGTGAGAATCCGTGTTATTTCAATTATC
CAATCAAGAGCCTAATTCGTATAAAAGAAACACAGCAGCTTGTTGCTCATCTTTTTATCT
AAGGACGGTTTGTCTTGACAGAGGGTGTCTGGCTGTTTTGGGGAAACTATTCCTGACCTT
ATTTTGACTAAAAAGTTGCCTGCTGTACCAGGGCCTGTGATGTGTTGATAAAATGCCACA
CAACCATTTCTCAGTGAAAAGCCCAACCGGGACTTGAGTTATGTTGGTGGCTATGGAGTT
CTGCAATCCACAATTGATGTTCTCTAATAACCAGTGACCTTGAGTGAACTGTCCCCAAGG
CAAGAGCAACCACAGCTGCGGGGAGCGTTTGGCAATCACTATCCCCACCCAAGCTTCTCC
CTTGGGTCTTGTCCTGTCACTCTGGCTGGAATACAATGGCGTAATCATAGCTCACTGCGG
CCTCCATCTCCTGGGTTCAAGTGATTCTCCTGCTTCAGCTTCCCAAGTATCTGGGACTAC
AGGCATCAAAAAATCACCATGTACCAACCTATCCAAACTTATCCATGGATGAATCTATCC
AGAAGACGGGAGTTCCGATGCTTGTCTTGCTCTGAATGTCTGCTTGTCACCTGCTTAGGG
TTATCGACTGTGATTCTGGGACTCATTGTTGTTCTACAGGACCCCTCTGACTCTGTGGTT
TTCTCTACTGGATTAACAATGATAGCCATAGGTGCTTTTTTTGTTGTCCTCACTGGAGTG
ACAGCCCTGTGTACGGTTACAGTCGACGAGAACTTGCAGAAAACCACGAGGCTAAGACTA
GGAGTGATACGAAAAAGCGGAAGTCTCCAAGGAACTACAGAGCCTTCCATGACTCACTCA
ATAATCGCTAGCACCTCGCTGTAGTTGTACATTGAACCCTGGCATCTTCGTCTTTGGAAC
TAAGTCTCCTGAGCATTGTTTTTAAATAGAAATAAAATCTGGCTTTTAAAAAAA

Protein Sequence

>400500 : length: 3
N/A