ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

399959

Name

MIR100HG

Synonym

AGD1|lncRNA-N2;mir-100-let-7a-2 cluster host gene;MIR100HG;mir-100-let-7a-2 cluster host gene

Definition

adipogenesis down-regulated transcript 1|lncRNA neuronal 2|mir-100-let-7a-2 cluster host gene (non-protein coding)

Position

11q24.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

399959

Links to epithelial mesenchymal transition gene database

399959

Links to ovarian cancer gene database

399959

Links to endometrial cancer gene database

399959

Links to iHOP

399959

Sequence Information

Nucleotide Sequence

>399959 : length: 3082
GAAGTTTTCTCCTCCTGTCCTGTAACTGGTTTTCACTCACTCAACTGAGAGATTTCTTTG
TTGCAATGATGGGGTCTAAGATAACACTTCTGGAGGCTGCAGGCGAGAAACACAGCTGAT
ATCATCTTTTATTGTGTGTTGTTATTTGCCTAGCATTATAAATTAAGGAGGAATAGTAAC
AAAGAGCTTGAAGACATGCACAGCTCACAGGCCCCGGGTGGAGGCTGGCGACATCAGACA
GACAGAACCAAGACATCTGAGGGGCAACCAGGAGGTGCGTGTGGCTGCAGAGCACACAGA
CTTGTCTTTGGACAAAATTGAGAAGAACTCATAAACTTGGCTTCCTCGCTTCTGCTCCTC
AGACGCGCGTGGATGATTTGAAGATATTAGCCTAACAAGATGGAAGCAGGTTTAAAATTT
TACATAAGAAGTTACCTTTTTCAGTTGTGTTGATGTTCCTTTCAGCTGGTCCTATAGTAC
CCCTCCTCAGGAATGTCTCCCCAGTGCAAGGACAAAGACTGAAGAGACTGCTATATTGAT
GGACTCTCAAGCCAACTATGAAGTTGAAACAAAGAAAGTGATCACCTGAAGACACCTCCT
CTGCTAAGAAACACCCCCAAATTGTGCAGCTTCTGCCACTAGAACTCTCAGAACAAGAGA
CAATCTTTTCAAGAAACAGAAAAACTCAATAATGACATCTAGATTTTCATGAGCCAAGAA
CTTTCCCTTCCTCATGTGTATTCCTCTGTTTGTACTTAAATTCATGTGACATTCATTTTT
TTCCTAGTATGGATATGCTTATTAATGCACTTGTTTCAAAATCCCAAATTGCACAAATGT
GTTAATATTTTAAGAAACAAAATGAATCCTACAAGGAGAATGATTTTTAGCCACACATAG
GGTTGGATCTTGAGAGTGACCTACAGAATAAAAGTACTTTTAAAATAAAGTAGTCAGAGG
CTATTCAAAGGGTAAAATAATCATAGTACCACATTGGTCCACTTGACACTAACCAATCGA
TCATTTTTTTTTAATCAAGAAAGCTAGATTCTATCAGATAAAATCACTGCTTCTAAAGAG
TTTAAATCTAGTTAGAAAAAGTTATAGAAATGTTTGCAAAGATAAGTAACAGATAGAGTC
AGTAGAGGATAAGATCAAAAACAAAACCAAGCAAAAGATGAGTTCAGGGGAGTTTGCCAT
CAAGTTGGCAAAACTGACTTACTTAGGGAAGAAAGTTATAAAACAGGAAAATATGAGATG
AACCTTGAGTGATGTGGAAGATTTAGATAAATGGAAAGGAAGGAGAAAATGGAGTTCTTT
AGGTGGTTGTAATTGGAGGAGGAAATGAATACACACATCTTGTTGACTTAAACCCAGACA
TTCAGCAGCTCTCTATACATATCTGGAAAAGACTGCACAGTCACCTCCTGTCTCTCACCC
CAGGTATTACTTAGAATTATTATCATATTTCCCTTCCTTTAAAGTAAGTAAGGGTGATTG
GTGACAATATGGAGAACTATGATTTTTCCATTAACCTAATAATAATTGGTATTTATTGAG
TTCTGTTAAGCATTTTACATATTAACTCACTTAAGCCTTTCAACAGCCTTGCAAAATAGG
TATTATTATCCCCATTTTACAGGCAAGAAAACTGAGGTTTAAGTAACTTGCCGAAGTGCC
ATATACAGGGCTCACATTCAGTATTGCAGTTGCAAAGCTCATGATCTATAGTGCCAAGTT
GCAATATTGTAGTCAATGTCACAATTATTACCCCTTTTTATATTCCTTGATATTTTTCCA
TGGCAAACAATTAGCTATTTCATTTAATAATCACCTAAAACTTTTCAGTCTTCTGATTAA
AATTACGCTGGAGTGATAGAATGTATTTTCATGATAGAAATTGGGAAAAAAAATGGGGAA
TGAAGTTTATCAGCATTTCAGACTTGTTTTTTTTTTTTTTTTTTGCAAGACTTTGATGAG
ATTGTTCACTTTTGTCTATGTAAAATCCCAAATCCTTGAGAATAAAAAAGGGGGAGGTTT
AAGTCACTTGTTGCAATGCCCTTTTTAATAGAGGCAATAAATCTAAAGGCCATAAATTTA
GAGTGACTTACAGAAGATCGAACTTTGGAGTGTGGCAGAGTAAGGGATGGAAACCGGGCC
CTCCAGTTCACTATCAGTAGCTTTTGCACTGGTCTGCCCTTCCTAAATTAAGTATGCACT
TCAATTTGATGAGTGGAAACAGTCTATCTGGGCAGTAACCAGGGAGCTTTGTGCCTAGTA
GATTGCTTCTGTTCTGCACTTCTTTGGTTTCCCACCTCAATGTAAAAAATAGCTAGCAAT
GAAGTCCAGAAGTTGTCAATGGTTCATCCCCAGAAGAATGCATAATGTCCAAAGTTGTAT
GTGTATGATGTCTTCAATGGTATTAAGTTATTTCAAATTCTTAGTTCACCTACATAAATC
ATTTCTAACAAGCATCTTCTTAACCAACTTTATGCACAGTGTATGTTTGTAAGTGCTTCT
GCACGAATGTTTATACATGACTGTTTCCATAGTACTTATGTTTTTAAAAATATTCAGTCA
TTTCCTACTATAATCCTCATGTATCCATGTAACTGACTCAAAAATACTTCAGCCACAGAA
AGCTAAAACTGAGCAAATCTCATTCTTCTTTTCCATCCCCTTTGCATGTGGCTGGCATTT
AGTAATGATTAATAATATGGCCAGCTGAATAACAGAGGTTTGAGACACAATTCTTTCTCA
AAGGAGTCAGCTAAGCTGGGTCTACTTATGGACAAACATCTAAATGTGTGGAAGTATCTG
ATATTTGACAATGGTAAATTTCCACTTAGCTAGCTAGCATTGTCAGACTTCAATCTCCTC
ATGGCTCTGGCCGTCCTGTTTTAAGCATGATAATTGTTGGCCACATCTCACATAGTTCTC
ATTGAGTGAGTTCATAAATAAACAGGGTTTTTTTTTTTTTTTAAAGAGCAGCCAAGCACA
AAGTGTGACTTTGTTGACATTTTATGTGACTTTGTCATATGTTCCTAACCCCCAATAAAA
GCAATGTTGCATCAACTGTGAA

Protein Sequence

>399959 : length: 3
N/A