ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

388815

Name

MIR99AHG

Synonym

C21orf34|C21orf35|FLJ38295|LINC00478|MONC;mir-99a-let-7c cluster host gene;MIR99AHG;mir-99a-let-7c cluster host gene

Definition

long intergenic non-protein coding RNA 478|megakaryocytic oncogenic non-coding RNA|mir-99a-let-7c cluster host gene (non-protein coding)

Position

21q21.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

388815

Links to epithelial mesenchymal transition gene database

388815

Links to ovarian cancer gene database

388815

Links to endometrial cancer gene database

388815

Links to iHOP

388815

Sequence Information

Nucleotide Sequence

>388815 : length: 3476
ATAAAGGACTTGTCTAGGGGAGAGCCTATGGATCTGAGAACGCTGTCTGGGCTTGGTACC
AAGAGCTGGTATTTCACAGCAGCGACCGCCTCACAGACGAGCTGTGGGAAGCAGGAGGGA
GACTCTCTCTTAGGGTGCCACTACTATGGAGACACAGCTGGGCTGAACAAGATTTGCTTC
AAACGACAACAAGAGAGACAGAAAGTATCTGGTTCAACCGCTGCCCGAGCAGGCAGGCAC
CAGAAGAGCTAGCAGCCAATCCGGCCATGCTCGAAGCCAGCTCTGCAGCTCAGCCAATCA
GTGACATCATTGCTTTCTTTAGCTTGCCCATGGTGATGTGAAGATGAGAAGAAATAGCAA
GGCCCAACCAGTTCTTCATCTGGAGACAGTTCAACGTTCTGCAAACCAGATCTTCAGGAA
TTTTACTGGGATAATTATCCAAATAAATTGCAAGCATTCTATCCAAATGGACATCCATAA
AAATTCATCAGAGAGCATTTTACTACTGAGCTGCAAAGGGAAAAACTTAAAATGGATATG
AAAAGTGAAGAAAGTGATCATAGGAGAAAACCATTTCAGGTGTCTGATGATTTGTGAGCC
TCAAGTGACTACTCTGTGGAATCATCTGTCCTTGCCTTTGAATTAGCTTTCCCTAGGCCA
TGAGTCAACATTAGTAGTTTATACATCCAAATTGATGACAAGAGCACCTCAAAGGCAGCA
GCCTCAAGGAGCAGCCATGGCCCCAGACTTGTCGCACGGATGCAGAAAACTTAATGGAGG
AGGCTGAGGTCAGAATGGGAAGAGTTTTTAAAAAATAAAAAGGGGAGCTAATATGTGAGG
AACTGATTGCTGTGCATTATTTTCCACTGAACAGACCTTCTTTTAACTTCTAATCTCAAG
CACATAGCAGCTGTTGTTTTCATATTAAAGATCAGTAAGTGTTTGTTGAATGAATGTATA
AATTCTTCCCCAATCTCTGTTCCATGTAATAAGAACTAAGTTAGCATTCAATTATAAAGA
GGACTTAGAAAGTCTGCAGACATTTTTGATCAAAAATCCTTTTAACTGTCTTCTTATGGT
TCCCGGTAACACCTAAGCCCAAAAAACTCAGGTCATTTCTTGCCTGTACTGTTGCAATAG
CCTCATAATAACTAGTCTTCTCCTTTATCAACCACAGTCGTCTCCGCTACACAAAGAAGA
GAGGGTGCTAATCTAAAGTGTAAATTATTTTAAATCAGCACCCTTCTTGTAATTTCCCAG
TGGTTTTTCCTGTCATAAGAATAACATGCAAAATTCCTTGCTTGCAAAGCCAGGTATGAC
CTTGCCCCGTCTACCTTACTGGCATCGTCTCTCATGACTCTTCCCCTTTTTCACTCTCCA
TCTTGCCTTTTCCCAACCATGCCTGCTAGTGAGCCTTAGCCCTTGTGTTTTCTCTGCCAG
GGATGCATGACTGGCTTCTTTACTTTATTCTGATCTCTCTGCTCAAATGTCATCTTTTTA
GAGATAGCTTTCCTAAACATCTTTAAAAGTACCCCATGAACTGTGAAACACCTTTCCTGC
TTTTTCTTCATAGTACTTATCACTTCCTGATATTATGTTAGACAACAAGCAAATAAGTAT
ATGCTGTTCCCACTAAAATATAAGCTCCATTTGAACAGGAGCCTTGATTATTCCTGAGTA
TACCCCTAGTGCCCAGAACCTAGTAGGGCTTTAATAAATATTAGATTCATTTGTTGAATG
AAAAAATGAATGAATAATTGAATAAAGATATCCAGGTAGAGTGTCCGGGCAGCCCAACCT
ATGTGAAGCCAGTACAAGAATGTTTCTGTGACATAGTGAGCGCAATTATTCCTCTAAATG
ATGAACTTGCATGAGTACACAAGGATAAAATTAAGCACGTAGTTTAGATTTCTGCAAGTC
TCTTCCTCAGATTGAGGAAAAACAAAGAAATTGAGCTTATTCTCACCTCATTCTTACATG
AACTAAATCCAGAATAAAGCATCATTTAAATACCAAGCACATCCCTACCTCAGCCACTCA
TGGAATACTTTATCTGTAAAGGGACAGATAGATAGTAAATATTTTTGGCTTTGGGGACCG
TACAGTCTGTGTCGCCACTACTCAGCACTTCTGTTGAGGTGTGGAATCAGCCCTAGACAA
CACATAAACAAATGGGTGTGGCTGTGTTCCAATAAAATGTTATTTATAAAACTAGGAAAT
CAGCAGATTTAGTCCACAGGCTGTAGTTTGCTGACCCTTGAATTAGAGAGTCTTCCCCAA
ATCCTCTTCCCAAGTTATTGAAAGAATGCCCATAGGACCATAGCTCCCTCACCTGGTTCT
TTCAAGAAATGAGACAAATTCAGGGATGGTTGGAGGGTGGAACGCCTACCTGTGACATGA
CTATTGAGCCTGATTTCTTTCCTTTTATCTCTTTAAAGTGAGTCAGGTCTTAACTTTAAA
CTGTCTCTAAAGTGGCAATAACTGGGCCATGTCAAATACTCCCAATGACAAAATTTCTTC
TTGGAGAATGAATGAGGGTTGCATACAGTGGTGTGTTGGTAAATGTTTAGCAACTGGCTC
TCTTACTGATTTCTGTAGTGTAAATTCTCCCATCCTGGCCATCTGAAACTACCAATATGA
TGTCACTTGATGTAGAGTTGGGAAAAGACAGTCTCTTGAATAAGTATGAGCTGGTTCCAG
CCCACTGCTGAACACATATTTAAAAGCTACAATAGCTCTGCTCACTGCCATTGCAGAGTC
TGGAGGAAAGAGTAGCAGGCTTGATAGGAGCAATTGGCTGAATAATCTTTTGCAATGCCA
ATAAATAATGAAAAAGTATATAAATATAACGCTGTATAGAAAGCTCTCAAGTTCAGTGTT
TGGTTAAAATACATACTCAGTAAATGGTAGCTATTATTGTCTTAGTTTAAGTTATTGCAA
GCATTAAAATTAAATGTTTAGCTACAGACTCAATCCAGTTTTAATGTCATTGTGTTAATA
AGGCCTCTTAACATTGAAGCAACAAAGATAAAGGAATTTTTTTGTAGCTATTCACGATTC
TGCCCAGCTCAAGGTAAAGATAGCAACAAAATACTCCAACCAGAATAAAAGAAGTCTCCA
CTTGACTGCAGCTCTTCGCAACACTTCACAAGGGTCAAGCTGTGTTAGTTTCCTTCAGTG
TTAAACAGAATGCATCTTAAGAGAATAGTTCAATTATTGATTGAATAGTAGGTTCAAGTT
GACTATAATCCCAACTAATACACTCTAAGACCAGGGATGGGCCGACAGAAGGGTAAAGTT
TTCCACTCAAGTCTCGAGGCAAACACTCAGATAGAAGTAGTAATATGGATGCCTTCTATT
ATTTGGTCACATACAATACTGTTCCAGCCCAGTTGTGCAAAACTGGTGAAATAAAAGGCA
AAAATATTGACAACAGTTTGGGTAACTGGATTCCAAAATGGGCATCCATCTAAGAG

Protein Sequence

>388815 : length: 3
N/A