ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

378938

Name

MALAT1

Synonym

HCN|LINC00047|NCRNA00047|NEAT2|PRO2853|mascRNA;metastasis associated lung adenocarcinoma transcript 1 (non-protein coding);MALAT1;metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)

Definition

MALAT1-associated small cytoplasmic RNA|hepcarcin|long intergenic non-protein coding RNA 47|nuclear enriched abundant transcript 2|nuclear paraspeckle assembly transcript 2 (non-protein coding)

Position

11q13.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

378938

Links to epithelial mesenchymal transition gene database

378938

Links to ovarian cancer gene database

378938

Links to endometrial cancer gene database

378938

Links to iHOP

378938

Sequence Information

Nucleotide Sequence

>378938 : length: 8758
GTAAAGGACTGGGGCCCCGCAACTGGCCTCTCCTGCCCTCTTAAGCGCAGCGCCATTTTA
GCAACGCAGAAGCCCGGCGCCGGGAAGCCTCAGCTCGCCTGAAGGCAGGTCCCCTCTGAC
GCCTCCGGGAGCCCAGGTTTCCCAGAGTCCTTGGGACGCAGCGACGAGTTGTGCTGCTAT
CTTAGCTGTCCTTATAGGCTGGCCATTCCAGGTGGTGGTATTTAGATAAAACCACTCAAA
CTCTGCAGTTTGGTCTTGGGGTTTGGAGGAAAGCTTTTATTTTTCTTCCTGCTCCGGTTC
AGAAGGTCTGAAGCTCATACCTAACCAGGCATAACACAGAATCTGCAAAACAAAAACCCC
TAAAAAAGCAGACCCAGAGCAGTGTAAACACTTCTGGGTGTGTCCCTGACTGGCTGCCCA
AGGTCTCTGTGTCTTCGGAGACAAAGCCATTCGCTTAGTTGGTCTACTTTAAAAGGCCAC
TTGAACTCGCTTTCCATGGCGATTTGCCTTGTGAGCACTTTCAGGAGAGCCTGGAAGCTG
AAAAACGGTAGAAAAATTTCCGTGCGGGCCGTGGGGGGCTGGCGGCAACTGGGGGGCCGC
AGATCAGAGTGGGCCACTGGCAGCCAACGGCCCCCGGGGCTCAGGCGGGGAGCAGCTCTG
TGGTGTGGGATTGAGGCGTTTTCCAAGAGTGGGTTTTCACGTTTCTAAGATTTCCCAAGC
AGACAGCCCGTGCTGCTCCGATTTCTCGAACAAAAAAGCAAAACGTGTGGCTGTCTTGGG
AGCAAGTCGCAGGACTGCAAGCAGTTGGGGGAGAAAGTCCGCCATTTTGCCACTTCTCAA
CCGTCCCTGCAAGGCTGGGGCTCAGTTGCGTAATGGAAAGTAAAGCCCTGAACTATCACA
CTTTAATCTTCCTTCAAAAGGTGGTAAACTATACCTACTGTCCCTCAAGAGAACACAAGA
AGTGCTTTAAGAGGTATTTTAAAAGTTCCGGGGGTTTTGTGAGGTGTTTGATGACCCGTT
TAAAATATGATTTCCATGTTTCTTTTGTCTAAAGTTTGCAGCTCAAATCTTTCCACACGC
TAGTAATTTAAGTATTTCTGCATGTGTAGTTTGCATTCAAGTTCCATAAGCTGTTAAGAA
AAATCTAGAAAAGTAAAACTAGAACCTATTTTTAACCGAAGAACTACTTTTTGCCTCCCT
CACAAAGGCGGCGGAAGGTGATCGAATTCCGGTGATGCGAGTTGTTCTCCGTCTATAAAT
ACGCCTCGCCCGAGCTGTGCGGTAGGCATTGAGGCAGCCAGCGCAGGGGCTTCTGCTGAG
GGGGCAGGCGGAGCTTGAGGAAACCGCAGATAAGTTTTTTTCTCTTTGAAAGATAGAGAT
TAATACAACTACTTAAAAAATATAGTCAATAGGTTACTAAGATATTGCTTAGCGTTAAGT
TTTTAACGTAATTTTAATAGCTTAAGATTTTAAGAGAAAATATGAAGACTTAGAAGAGTA
GCATGAGGAAGGAAAAGATAAAAGGTTTCTAAAACATGACGGAGGTTGAGATGAAGCTTC
TTCATGGAGTAAAAAATGTATTTAAAAGAAAATTGAGAGAAAGGACTACAGAGCCCCGAA
TTAATACCAATAGAAGGGCAATGCTTTTAGATTAAAATGAAGGTGACTTAAACAGCTTAA
AGTTTAGTTTAAAAGTTGTAGGTGATTAAAATAATTTGAAGGCGATCTTTTAAAAAGAGA
TTAAACCGAAGGTGATTAAAAGACCTTGAAATCCATGACGCAGGGAGAATTGCGTCATTT
AAAGCCTAGTTAACGCATTTACTAAACGCAGACGAAAATGGAAAGATTAATTGGGAGTGG
TAGGATGAAACAATTTGGAGAAGATAGAAGTTTGAAGTGGAAAACTGGAAGACAGAAGTA
CGGGAAGGCGAAGAAAAGAATAGAGAAGATAGGGAAATTAGAAGATAAAAACATACTTTT
AGAAGAAAAAAGATAAATTTAAACCTGAAAAGTAGGAAGCAGAAGAAAAAAGACAAGCTA
GGAAACAAAAAGCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAAACA
AGATAGAAAATGAAAATATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGCTAAGAC
AAGTATTGGAGAAGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATAAAATAGCA
CTGAAAAAATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATCAATTTAATTT
CTGGTGGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGTTTACGTAGACCAG
AACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTTAAAAATCACATCAAAA
AGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGCAGAAGGCTTTTGGAAGAGT
TAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTTTGAAAAATGTGAAGGACTTTC
GTAACGGAAGTAATTCAAGATCAAGAGTAATTACCAACTTAATGTTTTTGCATTGGACTT
TGAGTTAAGATTATTTTTTAAATCCTGAGGACTAGCATTAATTGACAGCTGACCCAGGTG
CTACACAGAAGTGGATTCAGTGAATCTAGGAAGACAGCAGCAGACAGGATTCCAGGAACC
AGTGTTTGATGAAGCTAGGACTGAGGAGCAAGCGAGCAAGCAGCAGTTCGTGGTGAAGAT
AGGAAAAGAGTCCAGGAGCCAGTGCGATTTGGTGAAGGAAGCTAGGAAGAAGGAAGGAGC
GCTAACGATTTGGTGGTGAAGCTAGGAAAAAGGATTCCAGGAAGGAGCGAGTGCAATTTG
GTGATGAAGGTAGCAGGCGGCTTGGCTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTG
TGCGTAGAGGATCCTAGACCAGCATGCCAGTGTGCCAAGGCCACAGGGAAAGCGAGTGGT
TGGTAAAAATCCGTGAGGTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCT
TTTATTTATTTTCTAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTATATG
GGGACGTAGGCCGATTTCCGGGTGTTGTAGGTTTCTCTTTTTCAGGCTTATACTCATGAA
TCTTGTCTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGGAGAAATAGTAGATGGCAAGT
TTGTGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCAAAT
TGAGACAATTTCAGCAAATCTGTAAGCAGTTTGTATGTTTAGTTGGGGTAATGAAGTATT
TCAGTTTTGTGAATAGATGACCTGTTTTTACTTCCTCACCCTGAATTCGTTTTGTAAATG
TAGAGTTTGGATGTGTAACTGAGGCGGGGGGGAGTTTTCAGTATTTTTTTTTGTGGGGGT
GGGGGCAAAATATGTTTTCAGTTCTTTTTCCCTTAGGTCTGTCTAGAATCCTAAAGGCAA
ATGACTCAAGGTGTAACAGAAAACAAGAAAATCCAATATCAGGATAATCAGACCACCACA
GGTTTACAGTTTATAGAAACTAGAGCAGTTCTCACGTTGAGGTCTGTGGAAGAGATGTCC
ATTGGAGAAATGGCTGGTAGTTACTCTTTTTTCCCCCCACCCCCTTAATCAGACTTTAAA
AGTGCTTAACCCCTTAAACTTGTTATTTTTTACTTGAAGCATTTTGGGATGGTCTTAACA
GGGAAGAGAGAGGGTGGGGGAGAAAATGTTTTTTTCTAAGATTTTCCACAGATGCTATAG
TACTATTGACAAACTGGGTTAGAGAAGGAGTGTACCGCTGTGCTGTTGGCACGAACACCT
TCAGGGACTGGAGCTGCTTTTATCCTTGGAAGAGTATTCCCAGTTGAAGCTGAAAAGTAC
AGCACAGTGCAGCTTTGGTTCATATTCAGTCATCTCAGGAGAACTTCAGAAGAGCTTGAG
TAGGCCAAATGTTGAAGTTAAGTTTTCCAATAATGTGACTTCTTAAAAGTTTTATTAAAG
GGGAGGGGCAAATATTGGCAATTAGTTGGCAGTGGCCTGTTACGGTTGGGATTGGTGGGG
TGGGTTTAGGTAATTGTTTAGTTTATGATTGCAGATAAACTCATGCCAGAGAACTTAAAG
TCTTAGAATGGAAAAAGTAAAGAAATATCAACTTCCAAGTTGGCAAGTAACTCCCAATGA
TTTAGTTTTTTTCCCCCCAGTTTGAATTGGGAAGCTGGGGGAAGTTAAATATGAGCCACT
GGGTGTACCAGTGCATTAATTTGGGCAAGGAAAGTGTCATAATTTGATACTGTATCTGTT
TTCCTTCAAAGTATAGAGCTTTTGGGGAAGGAAAGTATTGAACTGGGGGTTGGTCTGGCC
TACTGGGCTGACATTAACTACAATTATGGGAAATGCAAAAGTTGTTTGGATATGGTAGTG
TGTGGTTCTCTTTTGGAATTTTTTTCAGGTGATTTAATAATAATTTAAAACTACTATAGA
AACTGCAGAGCAAAGGAAGTGGCTTAATGATCCTGAAGGGATTTCTTCTGATGGTAGCTT
TTGTATTATCAAGTAAGATTCTATTTTCAGTTGTGTGTAAGCAAGTTTTTTTTTAGTGTA
GGAGAAATACTTTTCCATTGTTTAACTGCAAAACAAGATGTTAAGGTATGCTTCAAAAAT
TTTGTAAATTGTTTATTTTAAACTTATCTGTTTGTAAATTGTAACTGATTAAGAATTGTG
ATAGTTCAGCTTGAATGTCTCTTAGAGGGTGGGCTTTTGTTGATGAGGGAGGGGAAACTT
TTTTTTTTTCTATAGACTTTTTTCAGATAACATCTTCTGAGTCATAACCAGCCTGGCAGT
ATGATGGCCTAGATGCAGAGAAAACAGCTCCTTGGTGAATTGATAAGTAAAGGCAGAAAA
GATTATATGTCATACCTCCATTGGGGAATAAGCATAACCCTGAGATTCTTACTACTGATG
AGAACATTATCTGCATATGCCAAAAAATTTTAAGCAAATGAAAGCTACCAATTTAAAGTT
ACGGAATCTACCATTTTAAAGTTAATTGCTTGTCAAGCTATAACCACAAAAATAATGAAT
TGATGAGAAATACAATGAAGAGGCAATGTCCATCTCAAAATACTGCTTTTACAAAAGCAG
AATAAAAGCGAAAAGAAATGAAAATGTTACACTACATTAATCCTGGAATAAAAGAAGCCG
AAATAAATGAGAGATGAGTTGGGATCAAGTGGATTGAGGAGGCTGTGCTGTGTGCCAATG
TTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGG
GAGCAGAAAACAGCAGGCAGCTGTTAACAGATAAGTTTAACTTGCATCTGCAGTATTGCA
TGTTAGGGATAAGTGCTTATTTTTAAGAGCTGTGGAGTTCTTAAATATCAACCATGGCAC
TTTCTCCTGACCCCTTCCCTAGGGGATTTCAGGATTGAGAAATTTTTCCATCGAGCCTTT
TTAAAATTGTAGGACTTGTTCCTGTGGGCTTCAGTGATGGGATAGTACACTTCACTCAGA
GGCATTTGCATCTTTAAATAATTTCTTAAAAGCCTCTAAAGTGATCAGTGCCTTGATGCC
AACTAAGGAAATTTGTTTAGCATTGAATCTCTGAAGGCTCTATGAAAGGAATAGCATGAT
GTGCTGTTAGAATCAGATGTTACTGCTAAAATTTACATGTTGTGATGTAAATTGTGTAGA
AAACCATTAAATCATTCAAAATAATAAACTATTTTTATTAGAGAATGTATACTTTTAGAA
AGCTGTCTCCTTATTTAAATAAAATAGTGTTTGTCTGTAGTTCAGTGTTGGGGCAATCTT
GGGGGGGATTCTTCTCTAATCTTTCAGAAACTTTGTCTGCGAACACTCTTTAATGGACCA
GATCAGGATTTGAGCGGAAGAACGAATGTAACTTTAAGGCAGGAAAGACAAATTTTATTC
TTCATAAAGTGATGAGCATATAATAATTCCAGGCACATGGCAATAGAGGCCCTCTAAATA
AGGAATAAATAACCTCTTAGACAGGTGGGAGATTATGATCAGAGTAAAAGGTAATTACAC
ATTTTATTTCCAGAAAGTCAGGGGTCTATAAATTGACAGTGATTAGAGTAATACTTTTTC
ACATTTCCAAAGTTTGCATGTTAACTTTAAATGCTTACAATCTTAGAGTGGTAGGCAATG
TTTTACACTATTGACCTTATATAGGGAAGGGAGGGGGTGCCTGTGGGGTTTTAAAGAATT
TTCCTTTGCAGAGGCATTTCATCCTTCATGAAGCCATTCAGGATTTTGAATTGCATATGA
GTGCTTGGCTCTTCCTTCTGTTCTAGTGAGTGTATGAGACCTTGCAGTGAGTTTATCAGC
ATACTCAAAATTTTTTTCCTGGAATTTGGAGGGATGGGAGGAGGGGGTGGGGCTTACTTG
TTGTAGCTTTTTTTTTTTTTACAGACTTCACAGAGAATGCAGTTGTCTTGACTTCAGGTC
TGTCTGTTCTGTTGGCAAGTAAATGCAGTACTGTTCTGATCCCGCTGCTATTAGAATGCA
TTGTGAAACGACTGGAGTATGATTAAAAGTTGTGTTCCCCAATGCTTGGAGTAGTGATTG
TTGAAGGAAAAAATCCAGCTGAGTGATAAAGGCTGAGTGTTGAGGAAATTTCTGCAGTTT
TAAGCAGTCGTATTTGTGATTGAAGCTGAGTACATTTTGCTGGTGTATTTTTAGGTAAAA
TGCTTTTTGTTCATTTCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTCCAGATGC
AACCTTAAAATCAGTGACAAGAAACATTCCAAACAAGCAACAGTCTTCAAGAAATTAAAC
TGGCAAGTGGAAATGTTTAAACAGTTCAGTGATCTTTAGTGCATTGTTTATGTGTGGGTT
TCTCTCTCCCCTCCCTTGGTCTTAATTCTTACATGCAGGAACACTCAGCAGACACACGTA
TGCGAAGGGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCCTATTTACTTTAAATAAA
CCAAACATTCCATTTTAAATGTGGGGATTGGGAACCACTAGTTCTTTCAGATGGTATTCT
TCAGACTATAGAAGGAGCTTCCAGTTGAATTCACCAGTGGACAAAATGAGGAAAACAGGT
GAACAAGCTTTTTCTGTATTTACATACAAAGTCAGATCAGTTATGGGACAATAGTATTGA
ATAGATTTCAGCTTTATGCTGGAGTAACTGGCATGTGAGCAAACTGTGTTGGCGTGGGGG
TGGAGGGGTGAGGTGGGCGCTAAGCCTTTTTTTAAGATTTTTCAGGTACCCCTCACTAAA
GGCACCGAAGGCTTAAAGTAGGACAACCATGGAGCCTTCCTGTGGCAGGAGAGACAACAA
AGCGCTATTATCCTAAGGTCAAGAGAAGTGTCAGCCTCACCTGATTTTTATTAGTAATGA
GGACTTGCCTCAACTCCCTCTTTCTGGAGTGAAGCATCCGAAGGAATGCTTGAAGTACCC
CTGGGCTTCTCTTAACATTTAAGCAAGCTGTTTTTATAGCAGCTCTTAATAATAAAGCCC
AAATCTCAAGCGGTGCTTGAAGGGGAGGGAAAGGGGGAAAGCGGGCAACCACTTTTCCCT
AGCTTTTCCAGAAGCCTGTTAAAAGCAAGGTCTCCCCACAAGCAACTTCTCTGCCACATC
GCCACCCCGTGCCTTTTGATCTAGCACAGACCCTTCACCCCTCACCTCGATGCAGCCAGT
AGCTTGGATCCTTGTGGGCATGATCCATAATCGGTTTCAAGGTAACGATGGTGTCGAGGT
CTTTGGTGGGTTGAACTATGTTAGAAAAGGCCATTAATTTGCCTGCAAATTGTTAACAGA
AGGGTATTAAAACCACAGCTAAGTAGCTCTATTATAATACTTATCCAGTGACTAAAACCA
ACTTAAACCAGTAAGTGGAGAAATAACATGTTCAAGAACTGTAATGCTGGGTGGGAACAT
GTAACTTGTAGACTGGAGAAGATAGGCATTTGAGTGGCTGAGAGGGCTTTTGGGTGGGAA
TGCAAAAATTCTCTGCTAAGACTTTTTCAGGTGAACATAACAGACTTGGCCAAGCTAGCA
TCTTAGCGGAAGCTGATCTCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCT
GAGAAAACAACACGTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAA
AAAAAAAAAGCAAAAGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAAT
CCCTGCGGCGTCTTTGCTTTGACTACTAATCTGTCTTCAGGACTCTTTCTGTATTTCTCC
TTTTCTCTGCAGGTGCTAGTTCTTGGAGTTTTGGGGAGGTGGGAGGTAACAGCACAATAT
CTTTGAACTATATACATCCTTGATGTATAATTTGTCAGGAGCTTGACTTGATTGTATATT
CATATTTACACGAGAACCTAATATAACTGCCTTGTCTTTTTCAGGTAATAGCCTGCAGCT
GGTGTTTTGAGAAGCCCTACTGCTGAAAACTTAACAATTTTGTGTAATAAAAATGGAGAA
GCTCTAAATTGTTGTGGTTCTTTTGTGAATAAAAAAATCTTGATTGGGGAAAAAAAAA

Protein Sequence

>378938 : length: 3
N/A