ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

285943

Name

HOXA-AS2

Synonym

HOXA3as;HOXA cluster antisense RNA 2;HOXA-AS2;HOXA cluster antisense RNA 2

Definition

HOXA cluster antisense RNA 2 (non-protein coding)

Position

7p15.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

285943

Links to epithelial mesenchymal transition gene database

285943

Links to ovarian cancer gene database

285943

Links to endometrial cancer gene database

285943

Links to iHOP

285943

Sequence Information

Nucleotide Sequence

>285943 : length: 1048
GAAAAGGAAACGCCAAGACATAGAAAACCACGCTTTTCCCGTAGGAAGAACCGATGATGA
GCCCTGATGAAAGAAGGAAGAAGACCCGCTGTCTGCGAAGGCCTAAAGGCCGCGGTTGCC
AGGAACCGTGGAGGGCCAACTCCTCCCAACCGCCCTGGTGCAAAGTCCCACGCGGCGAAG
AGTTTTGGAGCAGCGCTTACCTAGAAAGATGTTTAAATTCTGAACCAGGAATTGTCTCCA
ACTCCAGGCGCTCAGGGAATCGCCTTTTCCGGTGTCCAGGCGCTCTGCAGACAAATAAAC
AGCAGAAGCAAATGGTCACCGAGCCGGCAGTCAGCTTTCTGGGAGTGGGAGATGATGGGG
AAAGAGGAAAGAATCGTCCGCTCGCCGGACCCTGGCTTGGAGAAGTTCTGCGCTCCGCTG
GGACTCTGCGGGCCCTTTGCGTCTACAGACCTATCCCTGCCCCGACTACCCCTTCACTCA
GACCCAGGGAAGGACACGTTTCTATGCCTTACAGAGACTTGAAGCCTGAAAGCCTGGCCA
AGTTTGGGAAGAAGAGGAGCCCTCTCAGAGCTCAAGAGCCTTCCTACTCTTTGGAACTTT
TCCACAGTAGGCCAAGCTTGACAAGAGTTCAGCTCAAGTTGAACATACATACACACACTC
TCACACACAAATTATGTGAGCCGTCAGAATCCAAGTGAATCCAGCTCAAGCTATCTACAA
GGTTTTTACATGCAAGGTCAAGTATCTCAATCCAGAGGACTTTTGTTTTCTTAATGAAAA
GCTTAGAAAACACATGAATCTTAGATTTTTAATGTTTTTTAAATGGAGTTTATTCTTAGC
ACATGGCTTTCTATGTAGCCACATCACAATTTGTACAGTTCCACATAAGTCTAAATGCAC
TCCCCTCTCCCCAAAGACCGTGCCCCAGAAGGGGACAACAGTATCTCTGTAACAGTGTCT
TAAATAAATGCAAGTAAGAAAAACTAACATGTCACACCTACCATCAAGGTCTACACATCT
TAAGAATTAAATAATCTTGTGAGGTCCA

Protein Sequence

>285943 : length: 3
N/A