ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

283120

Name

H19

Synonym

ASM|ASM1|BWS|D11S813E|LINC00008|NCRNA00008|WT2;H19, imprinted maternally expressed transcript (non-protein coding);H19;H19, imprinted maternally expressed transcript (non-protein coding)

Definition

H19, imprinted maternally expressed untranslated mRNA|long intergenic non-protein coding RNA 8

Position

11p15.5

Gene Type

ncRNA

External Links

Links to cell senescence gene database

283120

Links to epithelial mesenchymal transition gene database

283120

Links to ovarian cancer gene database

283120

Links to endometrial cancer gene database

283120

Links to iHOP

283120

Sequence Information

Nucleotide Sequence

>283120 : length: 2362
AGTTAGAAAAAGCCCGGGCTAGGACCGAGGAGCAGGGTGAGGGAGGGGGTGGGATGGGTG
GGGGGTAACGGGGGAAACTGGGGAAGTGGGGAACCGAGGGGCAACCAGGGGAAGATGGGG
TGCTGGAGGAGAGCTTGTGGGAGCCAAGGAGCACCTTGGACATCTGGAGTCTGGCAGGAG
TGATGACGGGTGGAGGGGCTAGCTCGAGGCAGGGCTGGTGGGGCCTGAGGCCAGTGAGGA
GTGTGGAGTAGGCGCCCAGGCATCGTGCAGACAGGGCGACATCAGCTGGGGACGATGGGC
CTGAGCTAGGGCTGGAAAGAAGGGGGAGCCAGGCATTCATCCCGGTCACTTTTGGTTACA
GGACGTGGCAGCTGGTTGGACGAGGGGAGCTGGTGGGCAGGGTTTGATCCCAGGGCCTGG
GCAACGGAGGTGTAGCTGGCAGCAGCGGGCAGGTGAGGACCCCATCTGCCGGGCAGGTGA
GTCCCTTCCCTCCCCAGGCCTCGCTTCCCCAGCCTTCTGAAAGAAGGAGGTTTAGGGGAT
CGAGGGCTGGCGGGGAGAAGCAGACACCCTCCCAGCAGAGGGGCAGGATGGGGGCAGGAG
AGTTAGCAAAGGTGACATCTTCTCGGGGGGAGCCGAGACTGCGCAAGGCTGGGGGGTTAT
GGGCCCGTTCCAGGCAGAAAGAGCAAGAGGGCAGGGAGGGAGCACAGGGGTGGCCAGCGT
AGGGTCCAGCACGTGGGGTGGTACCCCAGGCCTGGGTCAGACAGGGACATGGCAGGGGAC
ACAGGACAGAGGGGTCCCCAGCTGCCACCTCACCCACCGCAATTCATTTAGTAGCAGGCA
CAGGGGCAGCTCCGGCACGGCTTTCTCAGGCCTATGCCGGAGCCTCGAGGGCTGGAGAGC
GGGAAGACAGGCAGTGCTCGGGGAGTTGCAGCAGGACGTCACCAGGAGGGCGAAGCGGCC
ACGGGAGGGGGGCCCCGGGACATTGCGCAGCAAGGAGGCTGCAGGGGCTCGGCCTGCGGG
CGCCGGTCCCACGAGGCACTGCGGCCCAGGGTCTGGTGCGGAGAGGGCCCACAGTGGACT
TGGTGACGCTGTATGCCCTCACCGCTCAGCCCCTGGGGCTGGCTTGGCAGACAGTACAGC
ATCCAGGGGAGTCAAGGGCATGGGGCGAGACCAGACTAGGCGAGGCGGGCGGGGCGGAGT
GAATGAGCTCTCAGGAGGGAGGATGGTGCAGGCAGGGGTGAGGAGCGCAGCGGGCGGCGA
GCGGGAGGCACTGGCCTCCAGAGCCCGTGGCCAAGGCGGGCCTCGCGGGCGGCGACGGAG
CCGGGATCGGTGCCTCAGCGTTCGGGCTGGAGACGAGGCCAGGTCTCCAGCTGGGGTGGA
CGTGCCCACCAGCTGCCGAAGGCCAAGACGCCAGGTCCGGTGGACGTGACAAGCAGGACA
TGACATGGTCCGGTGTGACGGCGAGGACAGAGGAGGCGCGTCCGGCCTTCCTGAACACCT
TAGGCTGGTGGGGCTGCGGCAAGAAGCGGGTCTGTTTCTTTACTTCCTCCACGGAGTCGG
CACACTATGGCTGCCCTCTGGGCTCCCAGAACCCACAACATGAAAGAAATGGTGCTACCC
AGCTCAAGCCTGGGCCTTTGAATCCGGACACAAAACCCTCTAGCTTGGAAATGAATATGC
TGCACTTTACAACCACTGCACTACCTGACTCAGGAATCGGCTCTGGAAGGTGAAGCTAGA
GGAACCAGACCTCATCAGCCCAACATCAAAGACACCATCGGAACAGCAGCGCCCGCAGCA
CCCACCCCGCACCGGCGACTCCATCTTCATGGCCACCCCCTGCGGCGGACGGTTGACCAC
CAGCCACCACATCATCCCAGAGCTGAGCTCCTCCAGCGGGATGACGCCGTCCCCACCACC
TCCCTCTTCTTCTTTTTCATCCTTCTGTCTCTTTGTTTCTGAGCTTTCCTGTCTTTCCTT
TTTTCTGAGAGATTCAAAGCCTCCACGACTCTGTTTCCCCCGTCCCTTCTGAATTTAATT
TGCACTAAGTCATTTGCACTGGTTGGAGTTGTGGAGACGGCCTTGAGTCTCAGTACGAGT
GTGCGTGAGTGTGAGCCACCTTGGCAAGTGCCTGTGCAGGGCCCGGCCGCCCTCCATCTG
GGCCGGGTGACTGGGCGCCGGCTGTGTGCCCGAGGCCTCACCCTGCCCTCGCCTAGTCTG
GAAGCTCCGACCGACATCACGGAGCAGCCTTCAAGCATTCCATTACGCCCCATCTCGCTC
TGTGCCCCTCCCCACCAGGGCTTCAGCAGGAGCCCTGGACTCATCATCAATAAACACTGT
TACAGCAAAAAAAAAAAAAAAA

Protein Sequence

>283120 : length: 3
N/A