ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

27004

Name

TCL6

Synonym

TNG1|TNG2;T-cell leukemia/lymphoma 6 (non-protein coding);TCL6;T-cell leukemia/lymphoma 6 (non-protein coding)

Definition

TCL1-neighboring gene 1|TCL1-neighboring gene 2

Position

14q32.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

27004

Links to epithelial mesenchymal transition gene database

27004

Links to ovarian cancer gene database

27004

Links to endometrial cancer gene database

27004

Links to iHOP

27004

Sequence Information

Nucleotide Sequence

>27004 : length: 3307
GTCAACAGCCACTTCCTCCCTGGGGCTTAACAGGCATTCCTTGAAGCCTGCCCCGGGCAG
TTAGTCCTTCCCTTTTGTGTGAACTCTCGGCTGTTTTCGTTGTCTGCACACAGAGCAGTG
GTCTAGGGAGCGAAGGGTTTTGGAATGGACCTTTTCCTTTCTTAGCTTGCTGTAGGGATT
GTGCTTCAGCTAAGTAAAGTGGAAAAACAGAAGTACAAAAGCAACAGCCCCAGATCTAAG
GGCACCGTAGCTCTGGAATCTGGATTTTATTCCAGATTCAACCCTCAGCAGGGAGTTGAA
GTGGTCAGCCCTGTGCTTTACAAGGCTGATTGGGCAGCACCCATAGTAGAATTGTCAATA
TAAAGTAATTGAAAGGATCAGAATCCAGGGTTTTCGTTGTTTTTAAGTTTTTAAGTTTTA
AAAACAAAGTTGTTTTTGTTCGTTTTTAAGTTTACTTCTCTTTAATCGGTCTCACTTTAT
TGACCAGGCTGGTTTCGAACTCCTGGGCTTAAGTGATTTCTCCTGTCTCAGCTTCTCAAA
GTGCTGGGATTACAGGCGTGAGCCGCTGCACCCAGCCCAGAATCCAGTTTTAAAGAGTTT
ATTCAAGCCAAAAGCTGGGAATGGCCATCTGAGAAACACAGACTCTAGGAAAATGGGGCC
AGGGCCCTGAAGTTAAAAGTTAAAGTCTTGCTTACATAGGCAGAAAGCAAAGACATTTAG
TAACCTTGTAGAACATTTTCTTGTATAACTTTTCTTGTTTTAACTTTCTTGTTTAACATT
TTCTATGCAAGGCTGGTTTATGAGTTACAACCTATAATTAATTATAGGTTGTTCCCCTGC
CTCCACCTTGTTTTCTTTTCTCTACAGCTTGTTTTCATTTCCTTTCCAATTTAAGAATGT
GTTTAACATTCTATCCCAGACAATGTGATGGTCATGAAGTCTCTGTCAGAGAGGAAAGAG
GGAGTTAATCTATAATGAAGATCAACAGTGAAGAGGAAAGGGGTCTTCCCTGGAACGCTT
CAGTCATATACGACATTTTACACAACAATAATGGACCTGTGTAAGGAGGTATGTGTGGGA
GAAGATTCCAGAAGGTCTTGAGACACTCCAGATGAAGGTTGGTGTGGGGCTGTGCTGCTG
GAGCACCAGAGAGTGAAAAGAGGTTATCTCCCTCTGTGCCAGGCCAGAGTGCAGTGGTGC
AATCACGGCTCACTGTAGTCTCAACCTCCTGGGCTCAAGAGATCCTCCCACTTCAGCCTC
CCAAGCAGCTAAGACTACAGTTATTTTATTCTTATGAGCTTGTGGGCTCCATCTACCAAC
CTCTGGGCAAATGCTCATCTGACTTCCATAGACACACAGCAAGCAGACAACCACACAAAG
AGGAAGAGGGAGAATATTTACCAGCCATGGAACATCTGCTCTGTGCTTATATCTCATATG
CATTATCTCTAATTATCAAAAGAAGGTTAGAAGCAAGGCACAAGTCATACCTACATTCAA
GGAGAGGGGACCATGCAAAGGATAAACTGCAGAGAGACAACAGATTTACATCCCAGACAC
ATTCACACTGGGCCAAGAGCAGCTGCCATTGCAGATTCGAGTCACGTCCTTTTTTCCTTC
CTTCTCCTTCTTGGAGTTACAACAGAAGCTGGGGAGGTGAGAGTGCAGAAAGGACGTGGA
TGAAGCAGAGAGGCACGTGCCTGTCTCATTCGCCTCTGGATCTGCTGCATCCAGGACTGT
GCCAGCACAAAGTGGGAGCCCGATAAATATTTATTGAAGAAATGAAAGGTGACAAAAGGC
AGAAGGAGGGAGACCCCAAAAAGAGAGATGGGATCCCACTATATTGCACAGGCTGGTCTC
AAACTCCTGAGCTCAAGCGATCCTCCTGCCTTGGCCTCCCACGGTGCTGAGACTACAGGT
GTGAGCCACCACTCCCAGCCTGATTTATATTTTATAAAGAGGCAACGATGGAGTACACAG
CTGAGCAATCTCTTGCATTTCTGGACCTTGAGCATCAGGAAGCTTAGGGAGGGTGAAAAC
TCAGAAGAAAGCTCAGAGTTGAGACCTTTGATTTTTTGCCCAGAGAGTCCAGCTAACACA
CTTTATAACCCAAAAGGCCTTACAAATATTTCAGAGCAGAGGCAGCATTTTTGCACTGGA
TAAACAAAGGTACGGTAATTTCTTCATAGTTTATTTTCATTACAAGTAATTCTTTTCCTG
AAGAAAAATTTATATTTCAGATTTATTTCCCCTCTCAAAGGGGAGGGGAGTTATAATATT
CTGTTTCCATAGCACCATTCCTCAAGATCAAACCCAGGCAGGCATTTTTACAGCACACAC
TTCCATATGTCATTGCTAATCCTCGCAACCTTGAGGAAACTGAGGTGCAAAGGGGTTGAG
GAATGTGTTCACCATCCCAAAGCCAACGAAGTGCCAGAACCCAAATCCAAGCTTGGCTGT
CTCATCCCCAAGGACGTACTCTTTATGCCGTTCCTTATGACTTTTCATGCAGCAGGTGCA
AGGCAGCAAGAATTTGGCTCTTCTGACATTTATCAGGCACCTGGTATGTGCCAGGCCTAC
TGTAAACCCCAAGATGACATGGTCCATGTCTATCCATTCAGCATCAGAGAGACTGTTATC
AGGACTTGAGGCCTGAGACACAGCCCTGAATCAGATGCAGGCCTCTGGTGTTTGCAAAGG
ATGCGTGAGTATGTGTATGTGTATGCGTGCATTGTGTGTAGGGGTGTGTGTATGTTGGGG
GTTGGGGGCAGAAAATGCTCCCTGAACTGTTGGTATTAAGGCAGATCTTTGATGGAGGGA
CTGGGGTGTGGAGACTTGAACCCTAGTTTCAAAGTGGGGACCTCGAACACTAGTATGGCC
AGCAGACAGGCTGGAGTTGCTGAATTGTCAGCTAGGTCTTTAATCCACTCCCCTTCTCTA
AATCAGGGTGGAATTGGACTCAGGGCTGGTTCAGGGCTGAGGTTTCCGGGGGATGAATGA
TTCCAGACAGTGGGAAGGGGTGATGGATGATGAACCTGGCAAGTCACAGGACTATGGACT
TGGCTGTATGTTGCATGTATGTGTAAGATCTGAGTTGAGACCTTTGATTTTTGCCCAGAA
AGTCCAGCTAACATACTATATAAGCCAGTGAGACCAGCCAGTGTCTGTTCATTGCCTCTG
CCTTGCCCCTATGCCTGCCCGCCTCCTATAGCAGGTCCCTATAGCATAATGAAAATGCGA
ACAACCTTTTCTCTGGACACTGGGGAATCTAGTCTGGTGGATAAAGATGGATGGCTGTTA
AACGATC

Protein Sequence

>27004 : length: 3
N/A