ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

220930

Name

ZEB1-AS1

Synonym

ZEB1 antisense RNA 1;ZEB1-AS1;ZEB1 antisense RNA 1

Definition

ZEB1 antisense RNA 1 (non-protein coding)

Position

10p11.22

Gene Type

ncRNA

External Links

Links to cell senescence gene database

220930

Links to epithelial mesenchymal transition gene database

220930

Links to ovarian cancer gene database

220930

Links to endometrial cancer gene database

220930

Links to iHOP

220930

Sequence Information

Nucleotide Sequence

>220930 : length: 2232
CTTACACCTAGAGGCTCTCGCTCTACGGCCGGAACCTTGTTGCTAGGGACCGGGCGGTTT
GCGGCAACCGTGGGCACTGCTGAATTTGAATTGAGGGGCGAGGGAAAAGTTTTCCTCAGG
TGTGGTGGGGAGAGGGAGGCGGATGCCGGGAAACCGTAGGGACGCGGTCAGAAAGGCGAC
GGGCTGTCGGAGTTGGAAAGGGACGCCTGGTTTCCCCCCAAGCGAACCGGGATGGGAAGT
GACTTCAATGAGATTGAACTTCAGCTGGATTGAAAGAGAGGCTAGAAGTTCCGCTTGCCA
GCAGCCTCCTTAGTAGAGCGGAATGAGTAATACCCACACGGTGCTTGTCTCACTTCCCCA
TCCGCACCCGGCCCTCACCTGCTGTCACCTCGGCCTCCCACACCCGGTCCGCGCTCCCCG
CCCTCTTCCTCGCGTAGAACCGTGGGATCCTAGGTGGCAGGACTCAGAGCTAAGGTATCC
ACAGGCCATGAATTCCTTCCTAAATGAGCGGTCATCGCCGTGCAGGACCTTAAGGCAAGA
AGCATCGGCTGACAGATGTGATCTCTGAACCTGATAGATTGCTGATTTTATCTTATTTTA
TCCTTGACTTGGTACAAGTTTTGGGATTTCTGAAAAGACCATACAGATAACCACAAATAT
CAAGAAAGTCGTCTTCAGTATTAAGTAGAATTTAGATTTAGGTTTCCTTCCTGCTTCCCA
CCTCCTTCGAATAAGGAAACGTCTTTGGGACCAACTTTATGGAATAAATAAGCTGAGCTG
TATTTCAAGTAATATAGTTATAAATTAACAATGTAGCAGTTATTGATAGAGAAATTGAGA
AAACTGAAACGTGACCGGAGTATTGGAAATAACGTAGTACATCACCTAGCACAATGACAC
ATAGTAGGTGCTCAATAAATTTATGCTTATAATTTTTGTCACTTCTATGGCAGGATTTTT
TTATTAGGTTAAAATTATCTTTTAAACACCTTCCGGAATTTTAGAATATTCATTAATAAT
GTCTTCAAACCTTTCAACTGAAATAAATTTACAGCTGAAGTCTGATGATTTAAAGTTAGA
AAGTTTAATCTTGAATATAAATGAACATTTTCTCTCCCACATTTTCTTGGGCATTTTGAG
AAGTAAATGCGTTATTTATTGGTCCATGAAATGTGACTGTAAATATTCTTTGCTATACAT
TATGTCTATATATCTGCATTCATCCTCAATGCCAAAACTAGAATCATTAGTCTTAATGAT
CATTTTAAGTACAGGCAGTCCTCGCTTTCCTTGATACCATGTTAACCGAAACTTGTGTAT
GTCAACACGGTGTCCTTGCTTTGCTTGGTTAAGTGTGAGTTCTTCCTCCCTTTTTTTAAG
AGTTGTACAATGTTTTTCAGTCGCCTACCGAATCAGGTCATAGACTATGGAATTGACCCC
ACCCCACCAACATTTTTACAGCTACCCTGATTTCTGACCAGAAAGGAAAAAAAAACTTTC
CAGCTCTATCACACATTTTACCTACTCTTAAACTTAGGAGGTATTACAAATAGCATTTTC
TCATGTTCTCTTTCTGGCCTGTACCTCCCTGCTAAGCTTCCTTCAGTGTTCATCCTCACC
TCATAGAGAGATGAAGTGAAGAGACAAACAGAAGTCATTTTCTTCCTTACTTTAGTGGTT
TCTGGTTTAGTTAGTTTGGGCCAAACTGTGGACAAGTACCTTTTCAGGTAACTTTTTTTT
CTTATTTCTATGTCCTCAACACCTAGTGGAGTACGTAGCCAATAGTAGATGCTTAATAAA
CATTTCTTAAATTAATATTGTTGACCTTTTCTGACCCTGTTCTTGACAGTAAGGTACATA
ATCTGCCTTCATCCCTTTAGTCCTTAGGAACAGATAAAGTCATGGATATGAAAGTGATCA
CTGTCATTAATATCCACATTAAAATTGCTCTTGATTTTAGTTTCTCCATAATCATTTTCC
CTAAACAATGAACTCTGTTCACCTTTTTTTTTAAAATATGCACAGTGAATATTACTGGTA
GCCCAAATCTTCTAACATAAAATTTCCATTTTGTAAAAGCTTCTGATAAGCATATATGTT
ATGAATTGAATGTTTGATTATTATACTTTAATATTCTTGAAAATATTGATACCTGGACTG
GAAAGAAAACAGACAAAAGTAAATCTCAGAATAAATTACTGCTTTAAACATGAAAAAAAA
AAAAAAAAAAAA

Protein Sequence

>220930 : length: 3
N/A