ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

114614

Name

MIR155HG

Synonym

BIC|MIRHG2|NCRNA00172;MIR155 host gene;MIR155HG;MIR155 host gene

Definition

B-cell receptor inducible|BIC transcript|MIR155 host gene (non-protein coding)|microRNA host gene 2 (non-protein coding)|primary MIRN155 transcript

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

114614

Links to epithelial mesenchymal transition gene database

114614

Links to ovarian cancer gene database

114614

Links to endometrial cancer gene database

114614

Links to iHOP

114614

Sequence Information

Nucleotide Sequence

>114614 : length: 1500
GCCGAGCCCGGGCCCAGCGCCGCCTGCAGCCTCGGGAAGGGAGCGGATAGCGGAGCCCCG
AGCCGCCCGCAGAGCAAGCGCGGGGAACCAAGGAGACGCTCCTGGCACTGCAGATAACTT
GTCTGCATTTCAAGAACAACCTACCAGAGACCTTACCTGTCACCTTGGCTCTCCCACCCA
ATGGAGATGGCTCTAATGGTGGCACAAACCAGGAAGGGGAAATCTGTGGTTTAAATTCTT
TATGCCTCATCCTCTGAGTGCTGAAGGCTTGCTGTAGGCTGTATGCTGTTAATGCTAATC
GTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATTAACAGTGTATGATGC
CTGTTACTAGCATTCACATGGAACAAATTGCTGCCGTGGGAGGATGACAAAGAAGCATGA
GTCACCCTGCTGGATAAACTTAGACTTCAGGCTTTATCATTTTTCAATCTGTTAATCATA
ATCTGGTCACTGGGATGTTCAACCTTAAACTAAGTTTTGAAAGTAAGGTTATTTAAAAGA
TTTATCAGTAGTATCCTAAATGCAAACATTTTCATTTAAATGTCAAGCCCATGTTTGTTT
TTATCATTAACAGAAAATATATTCATGTCATTCTTAATTGCAGGTTTTGGCTTGTTCATT
ATAATGTTCATAAACACCTTTGATTCAACTGTTAGAAATGTGGGCTAAACACAAATTTCT
ATAATATTTTTGTAGTTAAAAATTAGAAGGACTACTAACCTCCAGTTATATCATGGATTG
TCTGGCAACGTTTTTTAAAAGATTTAGAAACTGGTACTTTCCCCCAGGTAACGATTTTCT
GTTCAGGCAACTTCAGTTTAAAATTAATACTTTTATTTGACTCTTAAAGGGAAACTGAAA
GGCTATGAAGCTGAATTTTTTTAATGAAATATTTTTAACAGTTAGCAGGGTAAATAACAT
CTGACAGCTAATGAGATATTTTTTCCATACAAGATAAAAAGATTTAATCAAAAAATTTCA
TATTTGAAATGAAGTCCCAAATCTAGGTTCAAGTTCAATAGCTTAGCCACATAATACGGT
TGTGCGAGCAGAGAATCTACCTTTCCACTTCTAAGCCTGTTTCTTCCTCCATATGGGGAT
AATACTTTACAAGGTTGTTGTGAGGCTTAGATGAGATAGAGAATTATTCCATAAGATAAT
CAAGTGCTACATTAATGTTATAGTTAGATTAATCCAAGAACTAGTCACCCTACTTTATTA
GAGAAGAGAAAAGCTAATGATTTGATTTGCAGAATATTTAAGGTTTGGATTTCTATGCAG
TTTTTCTAAATAACCATCACTTACAAATATGTAACCAAACGTAATTGTTAGTATATTTAA
TGTAAACTTGTTTTAACAACTCTTCTCAACATTTTGTCCAGGTTATTCACTGTAACCAAA
TAAATCTCATGAGTCTTTAGTTGATTTAAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Protein Sequence

>114614 : length: 3
N/A