ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

102578074

Name

LINC01452

Synonym

PCAT5|TPCAT-10-36067;long intergenic non-protein coding RNA 1452;LINC01452;long intergenic non-protein coding RNA 1452

Definition

prostate cancer associated transcript 5 (non-protein coding)

Position

10p11.21

Gene Type

ncRNA

External Links

Links to cell senescence gene database

102578074

Links to epithelial mesenchymal transition gene database

102578074

Links to ovarian cancer gene database

102578074

Links to endometrial cancer gene database

102578074

Links to iHOP

102578074

Sequence Information

Nucleotide Sequence

>102578074 : length: 3550
CTCCTGAGGCTGCAGCAAGATCAGGGAAGCAAACCTTTGCAAATGAGACATGTACCGTGT
AAAATGGAAATGCTTTCCTTGGCAGTGAGTTAAGCATTTTCACGATAACAATTTGGAATC
CTAGAAAAATAACTGGATTTTGAAATGGAAAATGAGCTCTGCACTTTGCTACTTTTGTGA
CCCCACATCCTCATCTCCAAATGCGGATGTTACAACAGAGCTTGCTGCGGAAGTAAAATT
TCAAAATAATCCTCCAACGTGTTTGTGGCCTGAAGGAGCAGAGCAGCGGTGGGAACAATT
TAATTCCTAATAAAGTCCATACCTCTAAGTCGCTGCGTGTGTGCCATTGAAACGCAGAGA
AGTTGCTAGAACTCCTCCACTCCTGCAGAGCTGTTGCCTCTCTGGGCCTGTGTGACAATG
TTTGCTCTCCCTGCTGTCACTTTGCACTTCCCCGAGTCTCTCTGGATGGCACTTCATGAT
TTCTCCCTGAAGCAATGATGGAAGTATGTCAGCTGTCAAAGGTTCTGGCAGCAGAAGGCA
GCTGAGAATAAAGCGGCTTCACGGTAATGTCGGTGACCCCCTAACCATACCCCGCTTTCC
ACCGATGATTTGTCTGGACAGTGTTTAAAGCAGATGAAATATACATTTTTTGAATCAGGC
AACAGGAGATGACCAGTGCTGGGTTTCATGGGAACCAGAGGATTTACAACTTTGCTTGGG
CTCCACGTACCAGCAGGAGCCTGATGAGGAGGGCGGCTGTGTTCTGAATTGTTTTAGGAA
GTCTCCTTCAGCCCAAGACCGTCTGGACAAAATTGCCATGGGATCCTGTTGCTGCAGCAG
GATGTTACCAAGTGAGACGTTGACTCAAAGAAGGGGAGCTGAGATCAGGAAGGCCAAGAT
GGCATCCAAAAATTCAAACACACCAAGGAGGCCAGGTGCGATGGCTCACGCCTGTAATCC
TAGCACTTTGGAAGACCCAGGTGGGTGGATCACCTGAGGTTAGGAGTTTGAGACCAGCCT
GGCCAACATGGTGAAACCCCATCTCTACTTAAAAAAAAAAAAAATCAGCTGGGCGTGCTA
GAAGGCACCTGTAATCCCAGCTACTTGGAAGTCTGAGGCAGGAGAATTGTTTGAACCCGG
GAGGTTGAGGTTGCAGTGAGCCACGCCACTGCACTCTAGCCTGGGCAACAAGAGTGAAAT
TCAGTCTCAAAAAAAAAAAAAAAAAAAAAAAAACCAAAAAACAAAACCTCCAAAGGACAT
ATGTGTGCTCTTGCTCTCAGGAAGCTTGTGATTCCTGGGGAGAAACTGATCACACACACA
CCGAGTATTGTAAAGTGATTCAAAGTTGCACAAGGGAGAGGCAAGTTCTGAGTCTCCTCC
TGCCTCCCAGTTCCCTTCCTTGAATGCAGGGTCACTGACTGATTGGTCACATCCCAAGAC
CATGATTGGCTATTTTACAAGTAGACAAGGTCACCATGCTTTAACAGGCAAGGCCCCATG
AGCCACCTCTCTTTGTTGGAAGTTGCCTGCGTCTGGCCCTCCTCTCACTTCTTGAGTGTA
GGTTTGAGGTCTGGGAATGCTGCTGGTAGCTGTGGTCCATCCCTTTCAAGATTGGGATTT
GGAAGATAAAGGAAAGATCCTGTTTGGAGCCTGAGCCTAAGCATAGAGTTCCAGCCTGAG
GTTGCAGAGAGGCCCAGCCTTGGGTGTGGGTTCCAAGCCCAGATGGCAATAAAGGAGCAC
CCTGTCTTCCTACGGGCTGGAGTTCCTTTTGAGAGTGCTTCCTGGGAAATGTTGTCATAA
CATTGACAGGGCAGAATTTCAGCATTTCTCACCCTTGGCCCTAATATCCATCTCCCAAAT
CACCCCCAGTGCCAGGAATCATTAAGAAAGCAGTGGTAGTGTTGAGACAACCAAAAGGCT
GTTAGTTTGAGAACCGTCACATATAGCAGATGGAATTCTTGAAAAAGTGTCTTCAGCATT
AGGTAGAGGCATATTGTTATACATAAAGAAAGGCCGGAGAAAAACACCAAGAACTTTCTG
GGGTAACTTCTCTACAGGAGGTTGCTGTGTCCCCCTAGACAGCTCTATCAACAGGTGAGG
ACTGGGAATCTAGTGGTGAATTGATGTGACTGGGTTGGGGCAGAAATGCCATGGGGCCTG
ATGCAGCACAGCTGTACGTCATGGAAAATGATCCCTGAGACAGTCAGCAACTGGATGTAG
AATGAATCTGTTTAAGTAATGAGTGTTCGCTTTAGGAGAGCAGGATGCAGGACAATAGCC
AGGAGAGAGCAAAACCTGTTTGAAAGAGTTGAGGGATTTGTGATGTCCTGCCTGACACAC
CAGCACCCCTGATGATGCTGTCAATGGCTTTCTCTCAATTAGTCCCCCTGGACAGGTGGA
AGCCGAGGTAAGTTGGGTAATTGATGTCTTCATGCTTCCACAAAGGGCCTACTTTGGGAA
GATGGAATATGTTAATGCAGGTCCCTGCATGAAGCAGGGAATTCTGAACACATTTGCAGG
CCGGTGAAGGAAAGGTCCTTCCCCATGTCATGGTTCCACATGCTCTCCACCATAAACTTG
GAAGAATTCAAGCTGACACATCATGTGAAATTCAGGGTGAAAAAAGTCTGTTGAAATGGA
TAATGGAATGTGGAAGACCTGTGGAACATGTAGTTGGACCTTTAACTCTGTCTGTATCCA
CACAAAAGCCTGTAATAGAATGTTCAAGCATAACATCCTTGAATTTTTCAAAAATAACTT
TACAGCTGATCCATTTATTTTGTCGGTGGGGTGAGGGGACAGAGAGAAGAATGGGAAAGA
GAGTGAGAGCAGGGAAAGAGAAGAGTGATGATTGAAGGGGAAGAGAAGGAATTTTCTAAC
AACTCCTTGCCACAAAATGATGAGTGATGGTGAGTGATTTAATTAGGTCATTAAGTGGAT
GAAATAACATGGCCAAGGTAAACTTACGTAAACTGTTTCTTATTTAAATTATATTGGATA
CTTGGATCATCTGTTTAATAAAAAATCTCATCCACTCTTCAATATTGGCTTAAATCCTCT
CCCCTGAACAAAACCTTTTCTAAGCACTGCAACTGGGACATTTTTTAGTTCTTTTTACAT
TTTTTTTCCATATTATTTAGTTGAAACTAATTGCATGGAGCTCTATTCCACGTAGTTACT
TCCATGGGTCCATGAGTCTTATTTCTCCCCAAAGACATTTTTCTTAGGGAGGAAGAAACC
AAGCTACAAACGTTTTTCTCATGTGCTTCCTACACTGTGTTCTGTGCAGTAGATGCTGCT
GAACATTTGCCAGGAGCCTGATATTTGGAAAGTTTGGCTCATTTTCAAGGCTATGCAATT
TAATGATACTGACAAACCCCAAAATTTCTAGATCCCAATTAAGTACTTCATTGTCCTGAC
TTCATTCATCATAATGGAAAATTAACTTACTGTCTAATATCTCATTTTCTTCTCTTTAAT
ATAGATAATAATAAACTAACCCATGCAAATGTATTGAAGAATAATGAATAAATAAAATTT
ACAAGCAAAT

Protein Sequence

>102578074 : length: 3
N/A