ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100750225

Name

PCAT1

Synonym

PCA1|PCAT-1;prostate cancer associated transcript 1 (non-protein coding);PCAT1;prostate cancer associated transcript 1 (non-protein coding)

Definition

-

Position

8q24.21

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100750225

Links to epithelial mesenchymal transition gene database

100750225

Links to ovarian cancer gene database

100750225

Links to endometrial cancer gene database

100750225

Links to iHOP

100750225

Sequence Information

Nucleotide Sequence

>100750225 : length: 1992
ACACATGGATATTGGATATCTGCATAGGCAGCTTGCTCCACGCCAGTGCCTACCTGTGCA
GATGGGAAGGAAAGGAAAGTGGCAAGGAGGCAGAGAAAGCATCTGTACCCTTACAATTTG
GTGAGACAAGAATGTATGAATTCCCACAGGTCAAATTATAATGAAGAAAGGAACCTCTCT
TGAGTACAAAGAGCTACCTATGGTGGTCTGGAGCCGGAGGACCACAGCATCAAAGGATAT
AAGATGCATAGCCAACTGAGGAACCTGAGCAATTAAAGAGATCCACAGTTAAGTCACACT
TAACTGGCACTTGTGGAAGCCCCGCAAGGCCTGAAGGAGAGCTGACATAGGCACCCCGGA
GAGCCAGAATCTGGATCCCATCTTAATAAGGCCATGAACACCAGTGGAGAAGAGGCAGAA
ACACCAATGGATAAGGAACATTCACATCTTTCTTCCCATGTGCCTCTAAGTGCCAGTGCA
GGCCCCACAGGCCAAGCTACAGGGAGAAAGGAGATGACGCAAAGGAACCTAACTGGACTT
TAATCACTAGAAGTGAGAAGAGAAATCTATTGGAACCTCCCAAGATAATGCCAAGGGTCA
AAGGGTGCGCAGATACATAAGACCATGGAAATAATATCAGACAAAAAGCAGATTAGAGCA
ATTTTCTTTTTCGAGTTCAAAATGGGTTATAAAGCAGCGGAGACAAACCGCAACATCACC
AACGCCTTTGGCCCAGGAACTGCTAATGAAGGTACAGTGCAGTCACTGTTCAGGAAGTTT
TGCAAAGGAGACTAGAGCCTTGAAGATGAGGAGCATAGTGACCAGCCATTGGAAGTCGAC
AAAGACCAATTGAGAGGAATCATTGAAGCTGATCATCTTACAACTACACGAGAAGTTGTC
AAAGAACGCAATGTTGACCATTGTGTGGTCTTTTCGCATTTGAAGCAAATTGGAAAGGTG
AAAAACTTGATAAGTGGGTGCCTTGTGAGCTCAGCAAAAATCCAAAAAAATAATCATTTT
TAAGTGTTGTCTTCTCTTATTCTACGCAACAACAATAACCATTTTGCAATCGGATTGTGA
TGTGCAATGAAAAGTGGATTTGGGGCCGGGCGCGGTGGCTCACGCCTGTAATCTCAGCAC
TTTGGAAGGCCAAGGCGGGCAGATCACGAGGTCAGGAGATCAAGACCGTCCTGGCTAACA
CGGTGAAACCCCGTCTCTACTGAAAATACAAAAAATTAGCCGGGTGTGGTGGCTGGCGCC
TGTAGTCCCAGCTACAGGCTGAGGCAGGAGAATGGCATGAACCTGGGAGGCGGAGCTTGC
AGTGAGCCGAGACCGTGCCACTGCACTCCAGCCTGGGCGACAGAGCGATACTCCGTCAAA
AAAAAAAAAAAAAAAAAAAAAAGACAAGTGGATTTTATATATGGCAACCAGCAATGACCA
GCTCAGTGGCTGGACTGAGAAGAAGCTCCAAAGCACTTCCCAAAGCCAAACTTGCACCAA
AAAAAAGGTCAGGGTCACTGTTTGGTGGTCTGCTGCTGGTCTGATCCACCGCTGCTCTCT
GAATCCTGGCAAAACCATTACATCTGAGAAGTATGCTCAACAAATCAATGAGCTACGCCA
AAAACTGCAGCATCTGCAGCTGGCATTGGTCAACATAACGGGTCCAATTCTTCTCCACGA
CAACGCTCAACTGCACCTTGCGCAAGCAGCGCTTCAAAAGTTGAACAAATTGGGCTACAT
AGTTTTTCCTCATCCGCCATATTCACCTGACGTCTTGCCAACTAACTACCACTTCTTCAA
GTATCTCAACAACTTTTTGCAGGGAAAACACTTCCACAACCAGCAGGATGCAGAACACGC
TTTCCAAGAGTTTGTCGAATCCTGACGCACAGATTTTTATGCTACAGGAATAAACTAACT
TATTTCTCATTGGCAAAAATGTGTTGATTGTAATGGTTCCTATTTTGATGAATAAATGTG
TGTTTGAGCCTA

Protein Sequence

>100750225 : length: 3
N/A