ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100316868

Name

HOTTIP

Synonym

HOXA-AS6|HOXA13-AS1|NCRNA00213;HOXA distal transcript antisense RNA;HOTTIP;HOXA distal transcript antisense RNA

Definition

HOXA cluster antisense RNA 6 (non-protein coding)|HOXA distal transcript antisense RNA (non-protein coding)|HOXA13 antisense RNA 1 (non-protein coding)|HoxA transcript at the distal tip

Position

7p15.2

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100316868

Links to epithelial mesenchymal transition gene database

100316868

Links to ovarian cancer gene database

100316868

Links to endometrial cancer gene database

100316868

Links to iHOP

100316868

Sequence Information

Nucleotide Sequence

>100316868 : length: 4665
CCCTTCCTTTATCCCAGTGGGGCCCAGACCCGCGCAACCAGGCGGGGAGGGGAGGTGGGC
GCGCGATTGGGTTGCGATCTGGAGCAGTGGGGACAGGTCAGGAACCGGCGCGTATTTCTG
CAGTGAGACCACAGGACGGACATCGGCGCCTTCGGCTTCGATGGAGTTGCGATTTTGCTC
TTTCCAGGGAAACAGTGGCAGGGTGTTTGCTGCTTATCGGTTCCTGCGGATATGCCTGGG
TCCCAGGACATTCCACTGGAGGCTTGGACTGCATTTAGGAGCCCCTATCCCTTCCCTGTC
CACACTGTTAGTGAGCAATTTCATATGTTTGCATTTAGACCCATAGACTCAGAACGACTC
ATCACACACACACACAGTGTACACTGACACACTCACATTCGCACACTTAGGTATACAGCC
TGATCCTTGCTCTGACCTGGTAACAACGCTTCCTCCTCCAGAGACTTTGAGATAGAGCGA
GCGATCCCTGTGCACCATTCATCCATGCTCCCACCTCGCCAGTATGGCTGGCTTAGTTCT
GGAAGGGGCTTAAGAGGAACAAGCCCCAGCTGTGCTTCTGGCTGGGACTTAAACCCCCCT
TCTGGGCCCTAAAGCCACGCTTCTTTGTGGACCGGACCTGACTCTCCAGGAATCTGGGAA
CCCGCTATTTCACTCTATTTTGGGACAAGAAAAAGGGGCTCTTTGGGGCCACTTCCTGCC
TTCCCCTCAAGTAGGATCTCCAGCCTGCAGAGGGTGCCTAGTCCTTCTTTGCCCAAGAAC
CAGTCCAAGAAGCCTTTCCTCTGTGCCTGGGAAATGCAACCTTTTCTTGGGAGCATGGTA
GGGTGTTGGTGCTGAAGAACCAAGCAGCGACCCGTCTTGTAGCTGCCATGTTTTGTCGAG
GGGTTCTGGGGGTCCTGCTGCTTTAGAGCCACATACTTCCACTTCCTGATTCACTACTGT
GAGCTGGTCAGATGCCTAGAAGAGGAACAAGCGTTCAAAGTGAAAGTGGGCACATTACCG
GAATAGTGCTGGGGAGAGTGCTGGATTCTTTTCCACCCCAGGCGGACTGGTGAGAAGCCA
GGCTTGGACCTGTCCTCTGCTCCTAGCTTGCACACTCAGCCCTAAACTCAGAGCAGCACG
CATACCACCCCTCACACACACCCCACCATCTGCTGTCTAAGGCCCCTGGGCTTCCTGCAG
GATCCAGACCAATGTGGCTGGGCTTGGGCTTTTATCTGTCCTGATCCTGGATTTGTCCTG
ACCAATGTAAGTGTCGCCCAATAAAACCTTCTATGACCCCCACACCAGCCACCCCCCCAC
CAAGTGTGCCCTTTCCTTCTTGACTTTTTAGCAGTTCTGGGTAAATATTGATTTGCCCCC
AGTTTACCTTCTCCCTGACTGGCCATTTGCAGACTCAGGAACTAGCCTCTGTAGGGACTT
GATTTTTCTGTTACTTTCTGGCCGTTTCACCACCCCCCTTCCTCCCTCCAAGTGGCATTG
TAAAACTCACAGTGACAAAGAGACAGAGTAGGGTTCTAGGCCCCTGTTCCTGGGGACTTG
AAGGCGGTTTTACATACTGGTCAGACACGGCTGGAGGCCAAGGTCAAGTTGAAAGTTGCA
GTCCAGCCAGCATGAGAACTGCCATGCGAGCGTAGAGACACAGGCAGCAGCAAAAGGCCC
ATTGCCCACATCCCCTCACTCTTAATTTTCTCTCTCTTTTTAAAATTCTCGCCTCTGACT
CTGTTCGGCTGCCCAGAATTTTTTGGTGCCTTCGTGGGGTTTTTGGGGCGGTGTTTACCG
ACTCTTCTCTGCCTCCGCCCTGCTCAGCCAGGGCTTTGAGCCTCTTCGGTTTTCCGGCCA
GACCCGGAAAAACGAAAACACAGCTTGGGGAGCCCCCACTAGCCGGCGCCTGTGCCAGCT
CACCTCTGGCCATGGCGCAGCTGCCGGTGCACACGGCGGCCAAGGCCAGCTCCACATTCT
TCCCTCCCCCTCCCACTTCACCGTAGCCCCGAACCCTGCGCGCAGAGAAAGGGTCTCAGC
TCCACAGACGACTGGGTCCCTCCTCACCAAAAATGGTGAGACAAGATTTCATCTGTCGGC
CGAGGAGCCACAAGCAGGTACCACAAAGCCACTAGTGCACAGGGACTCAGAAAAGACGGC
AGGAGCCCAAGGAAAACTCCAATTTGAGTACAGCCCTGCCTTGTTTCCCCCAGAGAGTCC
CTGAGCAAGGAGACCTCCACCCCACACACACCATTTCAGAACAACCAGGTTCCAGACTCC
CATGAGGAGCATCTCCCACTGCAGAGCCTTGGCCAGCCGCGCCCGGACTCCTCAGAGCTG
GCGCAAACTCCGTCCTCCAAAACTCGGCTCTGGGAGGCCTAAGTGACTCCGAAGCCGGCG
GCAGCCGCGGCAGCGGCCGTGGTGGTGGAAGAGCTCTTTTCCCCGACAGTGCCACTGATC
GCTCTTCACTGGAGCTGGAAACAGCCTTCGCGGAAAGGACCGGAGCATGCGTTAGAAGCA
GAGGGAGCTTGGTGAAGGGCTCGGCTGGAAGGAGGAAACGCCTTCTCGCAGTGCGCGGCC
AGCCCGCGGGGGACACCGGCTTGCTGGACTGCAGGGGCCCGTGCCACCCAGGAAGTGACC
TGCGGGTCACTCAGCCGGGGCGCTGGGCGAGCGCGGGACGGCCCGGAGAATTCCGTGCGG
CTGCGACGGGAAAAGGACGAGGGGTCTCTGTACCCGACGCTGCCACTGGCCCAAAGGAAT
TTTACCCGCGAGCGCCCACCCCACCCTAGCTTGATGCTTACGCCCGCAACAAAACAGGAA
ACCAGGACTGGGCAGTGCATTCTTTAAGTCAACAAATACACTGAAGACTTCGAGCGTTTG
AAGGAAGGAGGGGGTTTGCACGTAAGCCTGGCCCCGCCGGGCTCGGCTTTCTCGCTGAGA
AAGCGGCGCAGGCAGCCAGGCGGCCTGGGCCCGCGGGGGTCCATCTCGCCCTAGACTCCT
AAGAACTCCCACGGCCCTGTTCCCAGCTGCGAATTCTTAATGCACAACGCGACGGAGGGA
AGGAAATTCACCAGCGCAGCGACGAGGAAGGGGAACTCAGGACCCCTTCAAGTACACACT
GAGGTGTGATCAGAGTTTTATGGGCACTTTATATGCTGTAATCATAACGATGTGTGTGCC
TTGATATGCACGCATATTCACGCATCAAACGTGCATACACACACAGAGTGAATGTGCGCA
TCCAATGTCATGTGGGTGAAATACAAGCATCATACCCAGCCCTACGAAAAAAAAATTCAC
CCTGTCGGACCAGGCTGGTGACATACTTCGCTGGCGCATCTCCTTACTCACTCTTACTTT
TCCGACCCCTCACCATTCCCTCTCCTGTGGCTTGGTAAATACACCTGCCCTCCGTGGAAG
GTGAGTCCTGGACTGGCGTTGCCAGGTTCGCATGTCCTCCCCAGAACCTCCGTCTGGCTC
CAGGGACTCTCACTGAGCGGGTCTAGAGCACCCAGCACTTTTCAAGGAACAGCCGCGGTT
CCTTTGTCCCGCGGCTCCAGCCCCGTTCGGCCCAGCTCTCAGGGAAACGAAGCGCTCAGT
AAGAACTTTTGATATTAGTTTGTATGGGTATTTACACTCTGGTGAGGGGAGCTGAGTACG
GAAGTTCCATTAATCATACTCCAACCTTGGGTTTAGATATTCAGTTTATGGGTTGGGAGA
GGGAGTTTGCCGGAAAGAAAGCATCAAGGTTGGCCGCTGACTCCAGAGAAATGAAAAGGG
AGCAAGGTCGTTTTCTGTTTCTGGAAATCAAGAATTAGGAATGGGCAACTACAGGTGCTA
ACCAACAGACCACTTTTTTGTTTTTTGGTAGCCCTTTGGCAGGGATAGTTTTTCCACCTT
TGCCCGATACAATTTAAAAAAAAAAATCCTTTTATTATGGAATTTGTCAAACACACACAC
AAGCATAACAAACCCCTAGGTACCCATCTCCAAGTTTTGACCCCTATTATAATTTCATCT
TCAGTGTTTTATTATCCACTTCCTCTCTCTCTATCTTTAGTATTTTAAAGTAAATCCCAG
ATAGCATCACATCATTTCACCCCCACCATAGGATTTCAAAGATCTGTTATATTTCAAGAT
TGAGTAAAAGGGCTTGAAATTGGGTTATTGCAATGAAACTCTAGAAAAAGCTTGAGGGTT
CACCCAGGAGTAAGCTGGACAAAAAAGGGGTTTGAGGGGTGGACCCATCTTGCCTAAAAA
TCTTGTCTCATCTTTCTAAAAATTACATATGAAAGAGGAAGATTTATGTTACTTTTTTAT
ATGAGAGAATCGTCCTTTAATAGAAAATTTCTATTGCTGCATCAGAATTATGGAGGAACA
CAAAAAACATACCTCAGTCCTTAGTGTGTCCTAAATTAACACATATTCACTTATTAGTGG
GTAAATGACTATATTTCATTTCAGCACAACTTCTCCCCTGGTAGAAACACAAAAGAAATT
TCTAATGATTAAACTAGGAAAGTTTGCACTGAATTGATGGCTTATCAGAGCAACCGCAGT
TTTCAGGAAGAAATTCAATGCCATGCGTTGAAAATATCCCCCTAGCAATAAGGGATTATT
TTTAAAAAAGAATGAATAAAGATGTTCTGGTTTCTTTTGTTTTAA

Protein Sequence

>100316868 : length: 3
N/A