ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100302263

Name

MIR1908

Synonym

MIRN1908|hsa-mir-1908;microRNA 1908;MIR1908;microRNA 1908

Definition

-

Position

-

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100302263

Links to epithelial mesenchymal transition gene database

100302263

Links to ovarian cancer gene database

100302263

Links to endometrial cancer gene database

100302263

Links to iHOP

100302263

Sequence Information

Nucleotide Sequence

>100302263 : length: 80
CGGGAATGCCGCGGCGGGGACGGCGATTGGTCCGTATGTGTGGTGCCACCGGCCGCCGGC
TCCGCCCCGGCCCCCGCCCC

Protein Sequence

>100302263 : length: 3
N/A