ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100126340

Name

MIR944

Synonym

MIRN944|hsa-mir-944;microRNA 944;MIR944;microRNA 944

Definition

-

Position

3q28

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100126340

Links to epithelial mesenchymal transition gene database

100126340

Links to ovarian cancer gene database

100126340

Links to endometrial cancer gene database

100126340

Links to iHOP

100126340

Sequence Information

Nucleotide Sequence

>100126340 : length: 88
GTTCCAGACACATCTCATCTGATATACAATATTTTCTTAAATTGTATAAAGAGAAATTAT
TGTACATCGGATGAGCTGTGTCTGGGAT

Protein Sequence

>100126340 : length: 3
N/A