ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100126333

Name

MIR708

Synonym

MIRN708|hsa-mir-708;microRNA 708;MIR708;microRNA 708

Definition

-

Position

11q14.1

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100126333

Links to epithelial mesenchymal transition gene database

100126333

Links to ovarian cancer gene database

100126333

Links to endometrial cancer gene database

100126333

Links to iHOP

100126333

Sequence Information

Nucleotide Sequence

>100126333 : length: 88
AACTGCCCTCAAGGAGCTTACAATCTAGCTGGGGGTAAATGACTTGCACATGAACACAAC
TAGACTGTGAGCTTCTAGAGGGCAGGGA

Protein Sequence

>100126333 : length: 3
N/A