ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100126313

Name

MIR744

Synonym

MIRN744|hsa-mir-744;microRNA 744;MIR744;microRNA 744

Definition

-

Position

17p12

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100126313

Links to epithelial mesenchymal transition gene database

100126313

Links to ovarian cancer gene database

100126313

Links to endometrial cancer gene database

100126313

Links to iHOP

100126313

Sequence Information

Nucleotide Sequence

>100126313 : length: 98
TTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAACCAC
GCACATGCTGTTGCCACTAACCTCAACCTTACTCGGTC

Protein Sequence

>100126313 : length: 3
N/A