ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

100124700

Name

HOTAIR

Synonym

HOXAS|HOXC-AS4|HOXC11-AS1|NCRNA00072;HOX transcript antisense RNA;HOTAIR;HOX transcript antisense RNA

Definition

HOX transcript antisense RNA (non-protein coding)|HOXC cluster antisense RNA 4 (non-protein coding)|hox transcript antisense intergenic RNA

Position

12q13.13

Gene Type

ncRNA

External Links

Links to cell senescence gene database

100124700

Links to epithelial mesenchymal transition gene database

100124700

Links to ovarian cancer gene database

100124700

Links to endometrial cancer gene database

100124700

Links to iHOP

100124700

Sequence Information

Nucleotide Sequence

>100124700 : length: 2370
CCAGTTCTCAGGCGAGAGCCGCGGCTGACAGGGTCTGGGACAGAAGGAAAGCCCTCCAGC
CTCCAGGCCCTGCCTTCTGCCTGCACATTCTGCCCTGATTTCCGGAACCTGGAAGCCTAG
GCAGGCAGTGGGGAACTCTGACTCGCCTGTGCTCTGGAGCTTGATCCGAAAGCTTCCACA
GTGAGGACTGCTCCGTGGGGGTAAGAGAGCACCAGGCACTGAGGCCTGGGAGTTCCACAG
ACCAACACCCCTGCTCCTGGCGGCTCCCACCCGGGACTTAGACCCTCAGGTCCCTAATAT
CCCGGAGGTGCTCTCAATCAGAAAGGTCCTGCTCCGCTTCGCAGTGGAATGGAACGGATT
TAGAAGCCTGCAGTAGGGGAGTGGGGAGTGGAGAGAGGGAGCCCAGAGTTACAGACGGCG
GCGAGAGGAAGGAGGGGCGTCTTTATTTTTTTAAGGCCCCAAAGAGTCTGATGTTTACAA
GACCAGAAATGCCACGGCCGCGTCCTGGCAGAGAAAAGGCTGAAATGGAGGACCGGCGCC
TTCCTTATAAGCTCGTTGGGGCCTAAGCCAGTACCGACCTGGTAGAAAAAGCAACCACGA
AGCTAGAGAGAGAGCCAGAGGAGGGAAGAGAGCGCCAGACGAAGGTGAAAGCGAACCACG
CAGAGAAATGCAGGCAAGGGAGCAAGGCGGCAGTTCCCGGAACAAACGTGGCAGAGGGCA
AGACGGGCACTCACAGACAGAGGTTTATGTATTTTTATTTTTTAAAATCTGATTTGGTGT
TCCATGAGGAAAAGGGAAAATCTAGGGAACGGGAGTACAGAGAGAATAATCCGGGTCCTA
GCTCGCCACATGAACGCCCAGAGAACGCTGGAAAAACCTGAGCGGGTGCCGGGGCAGCAC
CCGGCTCGGGTCAGCCACTGCCCCACACCGGGCCCACCAAGCCCCGCCCCTCGCGGCCAC
CGGGGCTTCCTTGCTCTTCTTATCATCTCCATCTTTATGATGAGGCTTGTTAACAAGACC
AGAGAGCTGGCCAAGCACCTCTATCTCAGCCGCGCCCGCTCAGCCGAGCAGCGGTCGGTG
GGGGGACTGGGAGGCGCTAATTAATTGATTCCTTTGGACTGTAAAATATGGCGGCGTCTA
CACGGAACCCATGGACTCATAAACAATATATCTGTTGGGCGTGAGTGCACTGTCTCTCAA
ATAATTTTTCCATAGGCAAATGTCAGAGGGTTCTGGATTTTTAGTTGCTAAGGAAAGATC
CAAATGGGACCAATTTTAGGAGGCCCAAACAGAGTCCGTTCAGTGTCAGAAAATGCTTCC
CCAAAGGGGTTGGGAGTGTGTTTTGTTGGAAAAAAGCTTGGGTTATAGGAAAGCCTTTCC
CTGCTACTTGTGTAGACCCAGCCCAATTTAAGAATTACAAGGAAGCGAAGGGGTTGTGTA
GGCCGGAAGCCTCTCTGTCCCGGCTGGATGCAGGGGACTTGAGCTGCTCCGGAATTTGAG
AGGAACATAGAAGCAAAGGTCCAGCCTTTGCTTCGTGCTGATTCCTAGACTTAAGATTCA
AAAACAAATTTTTAAAAGTGAAACCAGCCCTAGCCTTTGGAAGCTCTTGAAGGTTCAGCA
CCCACCCAGGAATCCACCTGCCTGTTACACGCCTCTCCAAGACACAGTGGCACCGCTTTT
CTAACTGGCAGCACAGAGCAACTCTATAATATGCTTATATTAGGTCTAGAAGAATGCATC
TTGAGACACATGGGTAACCTAATTATATAATGCTTGTTCCATACAGGAGTGATTATGCAG
TGGGACCCTGCTGCAAACGGGACTTTGCACTCTAAATATAGACCCCAGCTTGGGACAAAA
GTTGCAGTAGAAAAATAGACATAGGAGAACACTTAAATAAGTGATGCATGTAGACACAGA
AGGGGTATTTAAAAGACAGAAATAATAGAAGTACAGAAGAACAGAAAAAAAATCAGCAGA
TGGAGATTACCATTCCCAATGCCTGAACTTCCTCCTGCTATTAAGATTGCTAGAGAATTG
TGTCTTAAACAGTTCATGAACCCAGAAGAATGCAATTTCAATGTATTTAGTACACACACA
GTATGTATATAAACACAACTCACAGAATATATTTTCCATACATTGGGTAGGTATGCACTT
TGTGTATATATAATAATGTATTTTCCATGCAGTTTTAAAATGTAGATATATTAATATCTG
GATGCATTTTCTGTGCACTGGTTTTATATGCCTTATGGAGTATATACTCACATGTAGCTA
AATAGACTCAGGACTGCACATTCCTTGTGTAGGTTGTGTGTGTGTGGTGGTTTTATGCAT
AAATAAAGTTTTACATGTGGTGAATATAAA

Protein Sequence

>100124700 : length: 3
N/A